MD15G1107700.v1.1

Cotton fibre expressed protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Forward (+)
7521749 .. 7522162
414 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1107700.v1.1.491

Sequence Viewer

Length: 414 bp
ATGGCTAGGGAAACCTTGACACTCGTAAGCCGCAGCCTCAAGAGGGCGGTGAACAAAATCAACCTAGTTCTACTCAGCTTCAAATTAAACCGATTGCGCTTGGCTTCGATCCTCGGTTGCTGCTCTTCTCGAGCTTCTACGAGGCATTGTTTGAGCTTCAATGACCGGTTGGGGCTGTACAGCTGCATTGAAGATGAAAATACTAGTACTGATGGGAATCAACGCAGTTTGAGAAGGGTTCAAAGCACAAGGACCCGTGATCCTCCGAAGGATCAGTCTTTGGATGATCACAATGGTGATGATGGTGATGTCGATCGCAGGGCTGATGTTTTCATAGCGAATTTTCACCGGCAGCTGATGTTTGAGAGACAAGTTTCTTTGCAGCTAAGGTACTGCAGACGGGATAATTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

138

Amino Acids

15.88

Weight (kDa)

9.65

Isoelectric Point (pI)

56.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF761 PF05553 102 - 133 3.4e-10 Cotton fibre expressed protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 31, 47
AclWI GGATC 3 cut(s) 103, 254, 279
AcsI RAATTY 1 cut(s) 340
AfaI GTAC 3 cut(s) 179, 208, 392
AfiI CCNNNNNNNGG 1 cut(s) 43
AgeI ACCGGT 1 cut(s) 165
AgsI TTSAA 4 cut(s) 82, 160, 191, 242
AhlI ACTAGT 1 cut(s) 203
AleI CACNNNNGTG 1 cut(s) 294
AluBI AGCT 6 cut(s) 78, 134, 156, 183, 355, 385
AluI AGCT 6 cut(s) 78, 134, 156, 183, 355, 385
Alw26I GTCTC 1 cut(s) 361
AlwI GGATC 3 cut(s) 103, 254, 279
Ama87I CYCGRG 1 cut(s) 129
ApeKI GCWGC 5 cut(s) 33, 120, 183, 352, 382
ApoI RAATTY 1 cut(s) 340
ArsI GACNNNNNNTTYG 2 cut(s) 260, 292
AsiGI ACCGGT 1 cut(s) 165
AspLEI GCGC 1 cut(s) 99
AspS9I GGNCC 1 cut(s) 252
AsuHPI GGTGA 4 cut(s) 61, 308, 317, 338
AvaI CYCGRG 1 cut(s) 129
AvaII GGWCC 1 cut(s) 252
BbvI GCAGC 5 cut(s) 45, 107, 170, 364, 394
BccI CCATC 2 cut(s) 206, 296
BclI TGATCA 1 cut(s) 286
BcoDI GTCTC 1 cut(s) 361
BcuI ACTAGT 1 cut(s) 203
BfaI CTAG 3 cut(s) 6, 65, 204
BfmI CTRYAG 1 cut(s) 394
BisI GCNGC 6 cut(s) 31, 34, 121, 184, 353, 383
BlsI GCNGC 6 cut(s) 32, 35, 122, 185, 354, 384
BmcAI AGTACT 1 cut(s) 208
Bme18I GGWCC 1 cut(s) 252
BmeT110I CYCGRG 1 cut(s) 129
BmgT120I GGNCC 1 cut(s) 252
BmiI GGNNCC 1 cut(s) 254
Bpu10I CCTNAGC 1 cut(s) 386
BpuEI CTTGAG 1 cut(s) 23
BsaBI GATNNNNATC 2 cut(s) 216, 312
BsaJI CCNNGG 1 cut(s) 112
BsaWI WCCGGW 1 cut(s) 165
Bsc4I CCNNNNNNNGG 1 cut(s) 43
Bse118I RCCGGY 2 cut(s) 165, 348
Bse8I GATNNNNATC 2 cut(s) 216, 312
BseDI CCNNGG 1 cut(s) 112
BseGI GGATG 1 cut(s) 289
BseJI GATNNNNATC 2 cut(s) 216, 312
BseLI CCNNNNNNNGG 1 cut(s) 43
BseMII CTCAG 1 cut(s) 88
BseXI GCAGC 5 cut(s) 45, 107, 170, 364, 394
Bsh1285I CGRYCG 1 cut(s) 316
BshTI ACCGGT 1 cut(s) 165
BsiEI CGRYCG 1 cut(s) 316
BsiHKCI CYCGRG 1 cut(s) 129
BsiSI CCGG 2 cut(s) 166, 349
BslI CCNNNNNNNGG 1 cut(s) 43
BsmAI GTCTC 1 cut(s) 361
BsoBI CYCGRG 1 cut(s) 129
Bsp1407I TGTACA 1 cut(s) 177
Bsp143I GATC 5 cut(s) 108, 259, 271, 286, 313
BspACI CCGC 2 cut(s) 31, 47
BspCNI CTCAG 1 cut(s) 87
BspLI GGNNCC 1 cut(s) 254
BspMAI CTGCAG 1 cut(s) 398
BspPI GGATC 3 cut(s) 103, 254, 279
BspQI GCTCTTC 1 cut(s) 130
BsrFI RCCGGY 2 cut(s) 165, 348
BsrGI TGTACA 1 cut(s) 177
BssAI RCCGGY 2 cut(s) 165, 348
BssECI CCNNGG 1 cut(s) 112
BssMI GATC 5 cut(s) 108, 259, 271, 286, 313
Bst6I CTCTTC 1 cut(s) 130
BstAUI TGTACA 1 cut(s) 177
BstDEI CTNAG 2 cut(s) 74, 386
BstF5I GGATG 1 cut(s) 289
BstHHI GCGC 1 cut(s) 99
BstKTI GATC 5 cut(s) 111, 262, 274, 289, 316
BstMAI GTCTC 1 cut(s) 361
BstMBI GATC 5 cut(s) 108, 259, 271, 286, 313
BstMCI CGRYCG 1 cut(s) 316
BstSFI CTRYAG 1 cut(s) 394
BstV1I GCAGC 5 cut(s) 45, 107, 170, 364, 394
BtsCI GGATG 1 cut(s) 289
CfoI GCGC 1 cut(s) 99
Cfr10I RCCGGY 2 cut(s) 165, 348
Cfr13I GGNCC 1 cut(s) 252
Csp6I GTAC 3 cut(s) 178, 207, 391
CspAI ACCGGT 1 cut(s) 165
CviQI GTAC 3 cut(s) 178, 207, 391
DdeI CTNAG 2 cut(s) 74, 386
DpnI GATC 5 cut(s) 110, 261, 273, 288, 315
DpnII GATC 5 cut(s) 108, 259, 271, 286, 313
Eam1104I CTCTTC 1 cut(s) 130
EarI CTCTTC 1 cut(s) 130
Eco47I GGWCC 1 cut(s) 252
Eco88I CYCGRG 1 cut(s) 129
EcoO109I RGGNCCY 1 cut(s) 252
FaiI YATR 1 cut(s) 335
FbaI TGATCA 1 cut(s) 286
Fnu4HI GCNGC 6 cut(s) 31, 34, 121, 184, 353, 383
FokI GGATG 1 cut(s) 296
Fsp4HI GCNGC 6 cut(s) 31, 34, 121, 184, 353, 383
FspBI CTAG 3 cut(s) 6, 65, 204
GlaI GCGC 1 cut(s) 98
GluI GCNGC 6 cut(s) 31, 34, 121, 184, 353, 383
HapII CCGG 2 cut(s) 166, 349
HhaI GCGC 1 cut(s) 99
Hin6I GCGC 1 cut(s) 97
HinP1I GCGC 1 cut(s) 97
HinfI GANTC 1 cut(s) 217
HpaII CCGG 2 cut(s) 166, 349
HphI GGTGA 4 cut(s) 61, 308, 317, 338
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 1 cut(s) 267
Hpy188III TCNNGA 2 cut(s) 40, 129
Hpy8I GTNNAC 1 cut(s) 52
HpyAV CCTTC 2 cut(s) 228, 262
HpyCH4V TGCA 3 cut(s) 186, 382, 396
HpyF3I CTNAG 2 cut(s) 74, 386
HspAI GCGC 1 cut(s) 97
Ksp22I TGATCA 1 cut(s) 286
Kzo9I GATC 5 cut(s) 108, 259, 271, 286, 313
LguI GCTCTTC 1 cut(s) 130
LpnPI CCDG 3 cut(s) 179, 304, 362
Lsp1109I GCAGC 5 cut(s) 45, 107, 170, 364, 394
MaeI CTAG 3 cut(s) 6, 65, 204
MalI GATC 5 cut(s) 110, 261, 273, 288, 315
MboI GATC 5 cut(s) 108, 259, 271, 286, 313
MboII GAAGA 2 cut(s) 117, 203
MluCI AATT 3 cut(s) 83, 340, 406
MnlI CCTC 5 cut(s) 36, 47, 122, 135, 273
MseI TTAA 1 cut(s) 86
MslI CAYNNNNRTG 1 cut(s) 294
MspA1I CMGCKG 2 cut(s) 183, 355
MspI CCGG 2 cut(s) 166, 349
NdeII GATC 5 cut(s) 108, 259, 271, 286, 313
NlaIV GGNNCC 1 cut(s) 254
OliI CACNNNNGTG 1 cut(s) 294
PaeR7I CTCGAG 1 cut(s) 129
PciSI GCTCTTC 1 cut(s) 130
PfeI GAWTC 1 cut(s) 217
PinAI ACCGGT 1 cut(s) 165
PkrI GCNGC 6 cut(s) 32, 35, 122, 185, 354, 384
Ple19I CGATCG 1 cut(s) 316
PpuMI RGGWCCY 1 cut(s) 252
Psp5II RGGWCCY 1 cut(s) 252
PspN4I GGNNCC 1 cut(s) 254
PspPI GGNCC 1 cut(s) 252
PspPPI RGGWCCY 1 cut(s) 252
PstI CTGCAG 1 cut(s) 398
PvuI CGATCG 1 cut(s) 316
PvuII CAGCTG 2 cut(s) 183, 355
RsaI GTAC 3 cut(s) 179, 208, 392
RsaNI GTAC 3 cut(s) 178, 207, 391
RseI CAYNNNNRTG 1 cut(s) 294
SapI GCTCTTC 1 cut(s) 130
SaqAI TTAA 1 cut(s) 86
SatI GCNGC 6 cut(s) 31, 34, 121, 184, 353, 383
Sau3AI GATC 5 cut(s) 108, 259, 271, 286, 313
Sau96I GGNCC 1 cut(s) 252
ScaI AGTACT 1 cut(s) 208
SetI ASST 9 cut(s) 17, 66, 80, 136, 158, 185, 357, 387, 392
SfcI CTRYAG 1 cut(s) 394
Sfr274I CTCGAG 1 cut(s) 129
SinI GGWCC 1 cut(s) 252
SlaI CTCGAG 1 cut(s) 129
SmiMI CAYNNNNRTG 1 cut(s) 294
SmlI CTYRAG 2 cut(s) 38, 129
SmoI CTYRAG 2 cut(s) 38, 129
SpeI ACTAGT 1 cut(s) 203
Sse9I AATT 3 cut(s) 83, 340, 406
SsiI CCGC 2 cut(s) 31, 47
SspMI CTAG 3 cut(s) 6, 65, 204
TaqI TCGA 3 cut(s) 107, 130, 312
TasI AATT 3 cut(s) 83, 340, 406
TatI WGTACW 2 cut(s) 177, 206
TauI GCSGC 1 cut(s) 33
TfiI GAWTC 1 cut(s) 217
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
TseI GCWGC 5 cut(s) 33, 120, 183, 352, 382
TspDTI ATGAA 2 cut(s) 210, 322
VpaK11BI GGWCC 1 cut(s) 252
XapI RAATTY 1 cut(s) 340
XhoI CTCGAG 1 cut(s) 129
XspI CTAG 3 cut(s) 6, 65, 204
ZrmI AGTACT 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.