Rh1BG114000

Cotton fibre expressed protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
19434258 .. 19434885
628 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG114000.1

Sequence Viewer

Length: 525 bp
ATGACTCAATCATTCTCTAACACGCTTTCTAGTGACCCACAAAGTCATACCAGTTTCTTGCTCAAGAATCTTCTCAGTTCTATAAAAGGAAGCCCTAGCCTCTTCATTAGTCACCACCATATTCATTTCCAACAAGACAACATTGTAGTCATGGGTAGAGTCAGGAGTTTGTCACTTGTAAGACACCTGAAGAAATCAGTGAAGAAAGTGAGACTCATTTTGCTTGGCCTTAAACTACAGAGGTGGCGCATAGCTTCAGTTCTTGGATGCGCTGCAACTAAAAGGCGGTGTTTGAGCTTCAATGACAGATTGGGTTTGGAGGGCTGCTTAGAAGTTGATACATCTGATTATCAGAATAGCTCCCACTTGAGAAGAATTCATAGCACAATTAGTCGTTCTTCTTCAATTGATTATGAGGATGTTGATCAAAGGGCTGATGCTTTCATTGCTAATTTTCGACGGCAGCTCAGATTAGAGAGACAGGTTTCTCTGGAGCTACGCTACTGCCGGAGGGAGAGCATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

174

Amino Acids

20.08

Weight (kDa)

10.37

Isoelectric Point (pI)

60.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF761 PF05553 139 - 170 1e-11 Cotton fibre expressed protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 286
AcsI RAATTY 1 cut(s) 375
AcuI CTGAAG 2 cut(s) 209, 240
AgsI TTSAA 2 cut(s) 301, 405
AluBI AGCT 5 cut(s) 254, 297, 360, 466, 496
AluI AGCT 5 cut(s) 254, 297, 360, 466, 496
Alw26I GTCTC 2 cut(s) 205, 472
AoxI GGCC 1 cut(s) 226
ApeKI GCWGC 3 cut(s) 272, 324, 463
ApoI RAATTY 1 cut(s) 375
AspLEI GCGC 2 cut(s) 249, 272
AsuHPI GGTGA 1 cut(s) 104
BbvI GCAGC 3 cut(s) 259, 311, 475
BceAI ACGGC 1 cut(s) 476
BclI TGATCA 1 cut(s) 424
BcoDI GTCTC 2 cut(s) 205, 472
BfaI CTAG 2 cut(s) 30, 96
BfmI CTRYAG 1 cut(s) 236
BisI GCNGC 3 cut(s) 273, 325, 464
BlsI GCNGC 3 cut(s) 274, 326, 465
BmsI GCATC 2 cut(s) 257, 427
BpmI CTGGAG 1 cut(s) 512
BpuEI CTTGAG 2 cut(s) 47, 388
BsaBI GATNNNNATC 1 cut(s) 423
Bse1I ACTGG 1 cut(s) 51
Bse3DI GCAATG 1 cut(s) 444
Bse8I GATNNNNATC 1 cut(s) 423
BseGI GGATG 2 cut(s) 272, 424
BseJI GATNNNNATC 1 cut(s) 423
BseMI GCAATG 1 cut(s) 444
BseMII CTCAG 2 cut(s) 88, 481
BseNI ACTGG 1 cut(s) 51
BseXI GCAGC 3 cut(s) 259, 311, 475
BshFI GGCC 1 cut(s) 228
BsiSI CCGG 1 cut(s) 508
BsmAI GTCTC 2 cut(s) 205, 472
BsnI GGCC 1 cut(s) 228
Bsp143I GATC 1 cut(s) 424
BspACI CCGC 1 cut(s) 286
BspANI GGCC 1 cut(s) 228
BspCNI CTCAG 2 cut(s) 87, 480
BsrDI GCAATG 1 cut(s) 444
BsrI ACTGG 1 cut(s) 51
BssMI GATC 1 cut(s) 424
Bst6I CTCTTC 1 cut(s) 107
BstDEI CTNAG 3 cut(s) 74, 328, 467
BstF5I GGATG 2 cut(s) 272, 424
BstHHI GCGC 2 cut(s) 249, 272
BstKTI GATC 1 cut(s) 427
BstMAI GTCTC 2 cut(s) 205, 472
BstMBI GATC 1 cut(s) 424
BstMWI GCNNNNNNNGC 1 cut(s) 446
BstSFI CTRYAG 1 cut(s) 236
BstV1I GCAGC 3 cut(s) 259, 311, 475
BsuRI GGCC 1 cut(s) 228
BtsCI GGATG 2 cut(s) 272, 424
BtsIMutI CAGTG 1 cut(s) 204
CfoI GCGC 2 cut(s) 249, 272
CviAII CATG 1 cut(s) 151
DdeI CTNAG 3 cut(s) 74, 328, 467
DpnI GATC 1 cut(s) 426
DpnII GATC 1 cut(s) 424
Eam1104I CTCTTC 1 cut(s) 107
EarI CTCTTC 1 cut(s) 107
Eco57I CTGAAG 2 cut(s) 209, 240
EcoRI GAATTC 1 cut(s) 375
FaeI CATG 1 cut(s) 154
FaiI YATR 7 cut(s) 48, 83, 120, 152, 251, 381, 414
FatI CATG 1 cut(s) 150
FbaI TGATCA 1 cut(s) 424
Fnu4HI GCNGC 3 cut(s) 273, 325, 464
FokI GGATG 2 cut(s) 279, 431
Fsp4HI GCNGC 3 cut(s) 273, 325, 464
FspBI CTAG 2 cut(s) 30, 96
GlaI GCGC 2 cut(s) 248, 271
GluI GCNGC 3 cut(s) 273, 325, 464
GsuI CTGGAG 1 cut(s) 512
HaeIII GGCC 1 cut(s) 228
HapII CCGG 1 cut(s) 508
HhaI GCGC 2 cut(s) 249, 272
Hin1II CATG 1 cut(s) 154
Hin6I GCGC 2 cut(s) 247, 270
HinP1I GCGC 2 cut(s) 247, 270
HinfI GANTC 4 cut(s) 4, 67, 159, 213
HpaII CCGG 1 cut(s) 508
HphI GGTGA 1 cut(s) 104
Hpy188I TCNGA 3 cut(s) 346, 354, 470
Hpy188III TCNNGA 3 cut(s) 64, 163, 491
Hpy99I CGWCG 1 cut(s) 462
HpyCH4V TGCA 1 cut(s) 275
HpyF10VI GCNNNNNNNGC 1 cut(s) 446
HpyF3I CTNAG 3 cut(s) 74, 328, 467
Hsp92II CATG 1 cut(s) 154
HspAI GCGC 2 cut(s) 247, 270
Ksp22I TGATCA 1 cut(s) 424
Kzo9I GATC 1 cut(s) 424
LmnI GCTCC 2 cut(s) 365, 493
LpnPI CCDG 6 cut(s) 64, 148, 200, 467, 476, 521
Lsp1109I GCAGC 3 cut(s) 259, 311, 475
LweI GCATC 2 cut(s) 257, 427
MaeI CTAG 2 cut(s) 30, 96
MaeIII GTNAC 3 cut(s) 32, 110, 171
MalI GATC 1 cut(s) 426
MboI GATC 1 cut(s) 424
MboII GAAGA 7 cut(s) 62, 94, 202, 214, 384, 390, 393
MfeI CAATTG 1 cut(s) 405
MluCI AATT 4 cut(s) 375, 387, 405, 451
MlyI GAGTC 2 cut(s) 168, 207
MmeI TCCRAC 1 cut(s) 154
MnlI CCTC 5 cut(s) 110, 234, 313, 409, 504
MseI TTAA 1 cut(s) 231
MspI CCGG 1 cut(s) 508
MunI CAATTG 1 cut(s) 405
MwoI GCNNNNNNNGC 1 cut(s) 446
NdeII GATC 1 cut(s) 424
NlaIII CATG 1 cut(s) 154
NmuCI GTSAC 3 cut(s) 32, 110, 171
PfeI GAWTC 1 cut(s) 67
PkrI GCNGC 3 cut(s) 274, 326, 465
PleI GAGTC 2 cut(s) 167, 207
PpsI GAGTC 2 cut(s) 167, 207
SaqAI TTAA 1 cut(s) 231
SatI GCNGC 3 cut(s) 273, 325, 464
Sau3AI GATC 1 cut(s) 424
SchI GAGTC 2 cut(s) 168, 207
SetI ASST 8 cut(s) 189, 245, 256, 299, 362, 468, 486, 498
SfaNI GCATC 2 cut(s) 257, 427
SfcI CTRYAG 1 cut(s) 236
SmlI CTYRAG 2 cut(s) 62, 367
SmoI CTYRAG 2 cut(s) 62, 367
Sse9I AATT 4 cut(s) 375, 387, 405, 451
SsiI CCGC 1 cut(s) 286
SspMI CTAG 2 cut(s) 30, 96
TaqI TCGA 1 cut(s) 457
TasI AATT 4 cut(s) 375, 387, 405, 451
TfiI GAWTC 1 cut(s) 67
Tru1I TTAA 1 cut(s) 231
Tru9I TTAA 1 cut(s) 231
TscAI CASTG 1 cut(s) 204
TseFI GTSAC 3 cut(s) 32, 110, 171
TseI GCWGC 3 cut(s) 272, 324, 463
Tsp45I GTSAC 3 cut(s) 32, 110, 171
TspDTI ATGAA 4 cut(s) 94, 113, 368, 433
TspRI CASTG 1 cut(s) 204
XapI RAATTY 1 cut(s) 375
XspI CTAG 2 cut(s) 30, 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.