MD15G1348700.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Reverse (-)
41302349 .. 41302682
334 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1348700.v1.1.491

Sequence Viewer

Length: 168 bp
ATGAGGGAGACACCTTCTCTGGAAACTTTGTTGCAATCGACCTACGCCAACCCCATAGCCATCTCCGTCGGTGCAATTCCTCCGGATTTGAAGGAGGCGATTGTGAAGGGATTAGGGTTTCAAGTGGAGGATTTGAAGGTGTTGGGGTTCGATTTAAGGGACACGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

5.97

Weight (kDa)

4.51

Isoelectric Point (pI)

25.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 82
AflIII ACRYGT 1 cut(s) 162
AgsI TTSAA 3 cut(s) 91, 122, 136
Alw26I GTCTC 1 cut(s) 2
Aor13HI TCCGGA 1 cut(s) 82
BccI CCATC 1 cut(s) 68
BcoDI GTCTC 1 cut(s) 2
BsaAI YACGTR 1 cut(s) 165
BsaWI WCCGGW 1 cut(s) 82
BseAI TCCGGA 1 cut(s) 82
BsiSI CCGG 1 cut(s) 83
BsmAI GTCTC 1 cut(s) 2
Bsp13I TCCGGA 1 cut(s) 82
BspEI TCCGGA 1 cut(s) 82
BstBAI YACGTR 1 cut(s) 165
BstMAI GTCTC 1 cut(s) 2
CviJI RGCY 1 cut(s) 59
CviKI_1 RGCY 1 cut(s) 59
FaiI YATR 1 cut(s) 56
HapII CCGG 1 cut(s) 83
HpaII CCGG 1 cut(s) 83
Hpy188III TCNNGA 2 cut(s) 20, 83
Hpy99I CGWCG 1 cut(s) 71
HpyAV CCTTC 4 cut(s) 24, 85, 100, 130
HpyCH4IV ACGT 1 cut(s) 164
HpyCH4V TGCA 2 cut(s) 34, 74
HpySE526I ACGT 1 cut(s) 164
Kpn2I TCCGGA 1 cut(s) 82
LpnPI CCDG 2 cut(s) 5, 96
MaeII ACGT 1 cut(s) 164
MluCI AATT 1 cut(s) 75
MnlI CCTC 3 cut(s) 88, 90, 121
MroI TCCGGA 1 cut(s) 82
MseI TTAA 1 cut(s) 155
MspI CCGG 1 cut(s) 83
Ppu21I YACGTR 1 cut(s) 165
SaqAI TTAA 1 cut(s) 155
SetI ASST 4 cut(s) 16, 44, 141, 167
SgeI CNNG 3 cut(s) 32, 95, 134
Sse9I AATT 1 cut(s) 75
TaiI ACGT 1 cut(s) 167
TaqI TCGA 2 cut(s) 38, 150
TasI AATT 1 cut(s) 75
Tru1I TTAA 1 cut(s) 155
Tru9I TTAA 1 cut(s) 155
TspGWI ACGGA 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.