MD16G1196100.v1.1

Thioredoxin-like 1-2, chloroplastic

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
Physical Location & Seq
Reverse (-)
17440423 .. 17440704
282 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1196100.v1.1.491

Sequence Viewer

Length: 282 bp
ATGATTTCTCCCTCCTTCAATACCTCACTATTTAATGATGCTAATCCAAGAGCTTTTCCTTCATTGAGTGTTGATTTCTTGGGAAAACCCATGACTCTCTCAGATCACAAGGGTTTGGAGAATTATAAGGTCAGAAAACCTAGCAATTTCTCTGTGCATGCACTAGCATCTGTCTGTGTAAGCAGAGCTATGAGGTGGTGGGAGAAGACCCTTCACCCCAACATGGTAGAGATCCATTCCGCTCAAGAACTTGTTGATTCCTTGAAAAATGTTGGGGACTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

10.44

Weight (kDa)

7.95

Isoelectric Point (pI)

24.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010978)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 126
AccBSI CCGCTC 1 cut(s) 242
AciI CCGC 1 cut(s) 240
AclWI GGATC 1 cut(s) 226
AfiI CCNNNNNNNGG 1 cut(s) 223
AgsI TTSAA 2 cut(s) 19, 265
AluBI AGCT 2 cut(s) 53, 188
AluI AGCT 2 cut(s) 53, 188
AlwI GGATC 1 cut(s) 226
AsuHPI GGTGA 1 cut(s) 206
BbsI GAAGAC 1 cut(s) 212
BfaI CTAG 2 cut(s) 141, 164
BmsI GCATC 2 cut(s) 28, 176
BpiI GAAGAC 1 cut(s) 212
BpuEI CTTGAG 1 cut(s) 228
BsaBI GATNNNNATC 1 cut(s) 42
Bsc4I CCNNNNNNNGG 1 cut(s) 223
Bse8I GATNNNNATC 1 cut(s) 42
BseJI GATNNNNATC 1 cut(s) 42
BseLI CCNNNNNNNGG 1 cut(s) 223
BseMII CTCAG 1 cut(s) 114
BslI CCNNNNNNNGG 1 cut(s) 223
Bsp143I GATC 2 cut(s) 103, 231
BspACI CCGC 1 cut(s) 240
BspCNI CTCAG 1 cut(s) 113
BspPI GGATC 1 cut(s) 226
BsrBI CCGCTC 1 cut(s) 242
BssMI GATC 2 cut(s) 103, 231
BstC8I GCNNGC 1 cut(s) 159
BstDEI CTNAG 1 cut(s) 100
BstKTI GATC 2 cut(s) 106, 234
BstMBI GATC 2 cut(s) 103, 231
BstNSI RCATGY 1 cut(s) 161
BstV2I GAAGAC 1 cut(s) 212
BstX2I RGATCY 1 cut(s) 231
BstYI RGATCY 1 cut(s) 231
Cac8I GCNNGC 1 cut(s) 159
CviAII CATG 3 cut(s) 91, 158, 223
CviJI RGCY 2 cut(s) 53, 188
CviKI_1 RGCY 2 cut(s) 53, 188
DdeI CTNAG 1 cut(s) 100
DpnI GATC 2 cut(s) 105, 233
DpnII GATC 2 cut(s) 103, 231
FaeI CATG 3 cut(s) 94, 161, 226
FaiI YATR 5 cut(s) 92, 126, 159, 191, 224
FatI CATG 3 cut(s) 90, 157, 222
FspBI CTAG 2 cut(s) 141, 164
Hin1II CATG 3 cut(s) 94, 161, 226
HinfI GANTC 2 cut(s) 94, 257
HphI GGTGA 1 cut(s) 206
Hpy188I TCNGA 2 cut(s) 103, 134
Hpy188III TCNNGA 1 cut(s) 245
HpyAV CCTTC 3 cut(s) 25, 69, 221
HpyCH4V TGCA 2 cut(s) 157, 161
HpyF3I CTNAG 1 cut(s) 100
Hsp92II CATG 3 cut(s) 94, 161, 226
Kzo9I GATC 2 cut(s) 103, 231
LweI GCATC 2 cut(s) 28, 176
MaeI CTAG 2 cut(s) 141, 164
MalI GATC 2 cut(s) 105, 233
MbiI CCGCTC 1 cut(s) 242
MboI GATC 2 cut(s) 103, 231
MboII GAAGA 1 cut(s) 217
MflI RGATCY 1 cut(s) 231
MluCI AATT 2 cut(s) 121, 145
MlyI GAGTC 1 cut(s) 88
MnlI CCTC 3 cut(s) 22, 34, 186
MseI TTAA 1 cut(s) 33
NdeII GATC 2 cut(s) 103, 231
NlaIII CATG 3 cut(s) 94, 161, 226
NspI RCATGY 1 cut(s) 161
PaeI GCATGC 1 cut(s) 161
PfeI GAWTC 1 cut(s) 257
PleI GAGTC 1 cut(s) 88
PpsI GAGTC 1 cut(s) 88
PsiI TTATAA 1 cut(s) 126
PsuI RGATCY 1 cut(s) 231
SaqAI TTAA 1 cut(s) 33
Sau3AI GATC 2 cut(s) 103, 231
SchI GAGTC 1 cut(s) 88
SetI ASST 6 cut(s) 26, 55, 132, 142, 190, 197
SfaNI GCATC 2 cut(s) 28, 176
SmlI CTYRAG 1 cut(s) 243
SmoI CTYRAG 1 cut(s) 243
SphI GCATGC 1 cut(s) 161
Sse9I AATT 2 cut(s) 121, 145
SsiI CCGC 1 cut(s) 240
SspMI CTAG 2 cut(s) 141, 164
TasI AATT 2 cut(s) 121, 145
TfiI GAWTC 1 cut(s) 257
Tru1I TTAA 1 cut(s) 33
Tru9I TTAA 1 cut(s) 33
TspDTI ATGAA 1 cut(s) 51
XceI RCATGY 1 cut(s) 161
XspI CTAG 2 cut(s) 141, 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.