MD17G1233400.v1.1

Domain of unknown function (DUF543)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
OG0010209
Physical Location & Seq
Forward (+)
28174408 .. 28174686
279 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1233400.v1.1.491

Sequence Viewer

Length: 279 bp
ATGGCGGACAACAAAGAAATCATCCAATCGCCGTGCGACGTGAACGCCAAATGGGACGCTTGTCTCGATCTGACCGTCCGCCGCTTCGTCTACTTCTCTTTGGGTGGTGCCTGTGGCGGTCTCCTTTTGTTCAGAAGTCTTGTGTCTCGTTGGGCTTCTGTAGCTTTTGGTGCTGGATTAGGCATTAGATCTGCATACACAGAGTGCTCTTGTTTGTTTGAGGGATCTCCAACAAAGTCGGTTGCTCCTAAGATGGTTGAATCACAGCAACCCAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF543

Protein Analysis

93

Amino Acids

9.95

Weight (kDa)

8.34

Isoelectric Point (pI)

89.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF543 PF04418 11 - 73 1e-17 Domain of unknown function (DUF543)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 107
AccI GTMKAC 1 cut(s) 90
AciI CCGC 4 cut(s) 5, 79, 82, 117
AclWI GGATC 1 cut(s) 232
AdeI CACNNNGTG 1 cut(s) 204
AgsI TTSAA 1 cut(s) 260
AjiI CACGTC 1 cut(s) 40
AluBI AGCT 1 cut(s) 164
AluI AGCT 1 cut(s) 164
Alw21I GWGCWC 1 cut(s) 209
Alw26I GTCTC 3 cut(s) 68, 125, 150
AlwI GGATC 1 cut(s) 232
BanI GGYRCC 1 cut(s) 107
Bbv12I GWGCWC 1 cut(s) 209
BccI CCATC 1 cut(s) 247
BceAI ACGGC 1 cut(s) 16
BcoDI GTCTC 3 cut(s) 68, 125, 150
BfmI CTRYAG 1 cut(s) 159
BglII AGATCT 1 cut(s) 188
BisI GCNGC 1 cut(s) 82
BlsI GCNGC 1 cut(s) 83
BmgBI CACGTC 1 cut(s) 40
BmiI GGNNCC 1 cut(s) 109
BoxI GACNNNNGTC 1 cut(s) 60
BsaI GGTCTC 1 cut(s) 125
BseGI GGATG 1 cut(s) 21
BshNI GGYRCC 1 cut(s) 107
BsiHKAI GWGCWC 1 cut(s) 209
BslFI GGGAC 1 cut(s) 68
BsmAI GTCTC 3 cut(s) 68, 125, 150
BsmFI GGGAC 1 cut(s) 68
Bso31I GGTCTC 1 cut(s) 125
Bsp1286I GDGCHC 1 cut(s) 209
Bsp143I GATC 3 cut(s) 67, 188, 224
BspACI CCGC 4 cut(s) 5, 79, 82, 117
BspLI GGNNCC 1 cut(s) 109
BspPI GGATC 1 cut(s) 232
BspT107I GGYRCC 1 cut(s) 107
BspTNI GGTCTC 1 cut(s) 125
BssMI GATC 3 cut(s) 67, 188, 224
Bst4CI ACNGT 1 cut(s) 76
BstDEI CTNAG 1 cut(s) 249
BstF5I GGATG 1 cut(s) 21
BstKTI GATC 3 cut(s) 70, 191, 227
BstMAI GTCTC 3 cut(s) 68, 125, 150
BstMBI GATC 3 cut(s) 67, 188, 224
BstMWI GCNNNNNNNGC 2 cut(s) 161, 170
BstPAI GACNNNNGTC 1 cut(s) 60
BstSFI CTRYAG 1 cut(s) 159
BstX2I RGATCY 2 cut(s) 188, 224
BstYI RGATCY 2 cut(s) 188, 224
BtrI CACGTC 1 cut(s) 40
BtsCI GGATG 1 cut(s) 21
CseI GACGC 1 cut(s) 65
CviJI RGCY 2 cut(s) 155, 164
CviKI_1 RGCY 2 cut(s) 155, 164
DdeI CTNAG 1 cut(s) 249
DpnI GATC 3 cut(s) 69, 190, 226
DpnII GATC 3 cut(s) 67, 188, 224
DraIII CACNNNGTG 1 cut(s) 204
EciI GGCGGA 2 cut(s) 20, 68
Eco31I GGTCTC 1 cut(s) 125
FaiI YATR 1 cut(s) 196
FaqI GGGAC 1 cut(s) 68
FblI GTMKAC 1 cut(s) 90
Fnu4HI GCNGC 1 cut(s) 82
FokI GGATG 1 cut(s) 8
Fsp4HI GCNGC 1 cut(s) 82
GluI GCNGC 1 cut(s) 82
HgaI GACGC 1 cut(s) 65
HinfI GANTC 1 cut(s) 260
Hpy166II GTNNAC 2 cut(s) 43, 91
Hpy188I TCNGA 2 cut(s) 72, 134
Hpy188III TCNNGA 1 cut(s) 65
Hpy8I GTNNAC 2 cut(s) 43, 91
Hpy99I CGWCG 1 cut(s) 41
HpyCH4III ACNGT 1 cut(s) 76
HpyCH4IV ACGT 1 cut(s) 39
HpyCH4V TGCA 1 cut(s) 194
HpyF10VI GCNNNNNNNGC 2 cut(s) 161, 170
HpyF3I CTNAG 1 cut(s) 249
HpySE526I ACGT 1 cut(s) 39
Kzo9I GATC 3 cut(s) 67, 188, 224
LmnI GCTCC 1 cut(s) 250
LpnPI CCDG 2 cut(s) 124, 159
MaeII ACGT 1 cut(s) 39
MalI GATC 3 cut(s) 69, 190, 226
MboI GATC 3 cut(s) 67, 188, 224
MflI RGATCY 2 cut(s) 188, 224
MhlI GDGCHC 1 cut(s) 209
MmeI TCCRAC 1 cut(s) 254
MnlI CCTC 1 cut(s) 214
MwoI GCNNNNNNNGC 2 cut(s) 161, 170
NdeII GATC 3 cut(s) 67, 188, 224
NlaIV GGNNCC 1 cut(s) 109
PcsI WCGNNNNNNNCGW 2 cut(s) 63, 72
PfeI GAWTC 1 cut(s) 260
PkrI GCNGC 1 cut(s) 83
PshAI GACNNNNGTC 1 cut(s) 60
PspN4I GGNNCC 1 cut(s) 109
PsuI RGATCY 2 cut(s) 188, 224
SatI GCNGC 1 cut(s) 82
Sau3AI GATC 3 cut(s) 67, 188, 224
SduI GDGCHC 1 cut(s) 209
SetI ASST 2 cut(s) 42, 166
SfcI CTRYAG 1 cut(s) 159
SgeI CNNG 9 cut(s) 45, 52, 72, 77, 123, 152, 159, 186, 222
SsiI CCGC 4 cut(s) 5, 79, 82, 117
TaaI ACNGT 1 cut(s) 76
TaiI ACGT 1 cut(s) 42
TaqI TCGA 1 cut(s) 66
TauI GCSGC 1 cut(s) 84
TfiI GAWTC 1 cut(s) 260
XmiI GTMKAC 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.