MD17G1248900.v1.1

Plant lipid transfer protein / seed storage protein / trypsin-alpha amylase inhibitor domain family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
OG0007035
Physical Location & Seq
Reverse (-)
29762870 .. 29763163
294 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1248900.v1.1.491

Sequence Viewer

Length: 294 bp
ATGAAGCTGTCATCAGGTAGTTTGGTGTTCTGTTTGATGGTGGCGGTGGTGGTGGCATTATGCGATGAGGTAAGGACGACAGAGGCAGTGACATGCAGTCCGTTGGAGTTGAGCCCATGCCTGGAGGCCATAAGGTCAGAGACACCACCTTCAGCCACATGCTGCGAGAAGCTGAAGGAGCAGCAACCTTGCCTCTGTGAATACATCAAGAACCCAGCCCTCAAGCCATACATCAACAACCCCAATGCCAAAAAAGTTGCTTTTGCCTGCGGCGTTCCCTTCCCTCAATGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LTP_2

Protein Analysis

98

Amino Acids

10.48

Weight (kDa)

6.19

Isoelectric Point (pI)

51.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Tryp_alpha_amyl PF00234 35 - 97 1.9e-11 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 44, 270
AcuI CTGAAG 2 cut(s) 135, 194
AfiI CCNNNNNNNGG 1 cut(s) 121
AhdI GACNNNNNGTC 1 cut(s) 96
AjnI CCWGG 1 cut(s) 120
AluBI AGCT 2 cut(s) 7, 172
AluI AGCT 2 cut(s) 7, 172
Alw26I GTCTC 1 cut(s) 134
AoxI GGCC 1 cut(s) 126
ApeKI GCWGC 2 cut(s) 162, 181
BanII GRGCYC 1 cut(s) 116
BbvI GCAGC 2 cut(s) 149, 193
BccI CCATC 1 cut(s) 31
BciT130I CCWGG 1 cut(s) 122
BcoDI GTCTC 1 cut(s) 134
BfaI CTAG 1 cut(s) 292
BisI GCNGC 3 cut(s) 163, 182, 271
BlsI GCNGC 3 cut(s) 164, 183, 272
Bme1390I CCNGG 1 cut(s) 122
BmeRI GACNNNNNGTC 1 cut(s) 96
BmrFI CCNGG 1 cut(s) 122
BpmI CTGGAG 1 cut(s) 143
BpuEI CTTGAG 1 cut(s) 206
Bsc4I CCNNNNNNNGG 1 cut(s) 121
BseBI CCWGG 1 cut(s) 122
BseLI CCNNNNNNNGG 1 cut(s) 121
BseXI GCAGC 2 cut(s) 149, 193
BseYI CCCAGC 1 cut(s) 214
BshFI GGCC 1 cut(s) 128
BslI CCNNNNNNNGG 1 cut(s) 121
BsmAI GTCTC 1 cut(s) 134
BsnI GGCC 1 cut(s) 128
Bsp1286I GDGCHC 1 cut(s) 116
BspACI CCGC 2 cut(s) 44, 270
BspANI GGCC 1 cut(s) 128
Bst2UI CCWGG 1 cut(s) 122
BstC8I GCNNGC 1 cut(s) 268
BstMAI GTCTC 1 cut(s) 134
BstMWI GCNNNNNNNGC 1 cut(s) 178
BstNI CCWGG 1 cut(s) 122
BstNSI RCATGY 2 cut(s) 96, 162
BstSCI CCNGG 1 cut(s) 120
BstV1I GCAGC 2 cut(s) 149, 193
BsuRI GGCC 1 cut(s) 128
BtgZI GCGATG 1 cut(s) 78
BtsI GCAGTG 1 cut(s) 93
BtsIMutI CAGTG 1 cut(s) 93
Cac8I GCNNGC 1 cut(s) 268
CviAII CATG 3 cut(s) 93, 117, 159
CviJI RGCY 7 cut(s) 7, 114, 128, 155, 172, 218, 226
CviKI_1 RGCY 7 cut(s) 7, 114, 128, 155, 172, 218, 226
DriI GACNNNNNGTC 1 cut(s) 96
Eam1105I GACNNNNNGTC 1 cut(s) 96
Eco24I GRGCYC 1 cut(s) 116
Eco57I CTGAAG 2 cut(s) 135, 194
EcoRII CCWGG 1 cut(s) 120
EcoT38I GRGCYC 1 cut(s) 116
FaeI CATG 3 cut(s) 96, 120, 162
FaiI YATR 6 cut(s) 61, 94, 118, 131, 160, 229
FatI CATG 3 cut(s) 92, 116, 158
Fnu4HI GCNGC 3 cut(s) 163, 182, 271
FriOI GRGCYC 1 cut(s) 116
Fsp4HI GCNGC 3 cut(s) 163, 182, 271
FspBI CTAG 1 cut(s) 292
GluI GCNGC 3 cut(s) 163, 182, 271
GsaI CCCAGC 1 cut(s) 218
GsuI CTGGAG 1 cut(s) 143
HaeIII GGCC 1 cut(s) 128
Hin1II CATG 3 cut(s) 96, 120, 162
Hpy188I TCNGA 1 cut(s) 139
Hpy188III TCNNGA 1 cut(s) 208
HpyAV CCTTC 3 cut(s) 159, 169, 289
HpyCH4V TGCA 1 cut(s) 96
HpyF10VI GCNNNNNNNGC 1 cut(s) 178
Hsp92II CATG 3 cut(s) 96, 120, 162
LmnI GCTCC 1 cut(s) 178
LpnPI CCDG 4 cut(s) 107, 134, 228, 280
Lsp1109I GCAGC 2 cut(s) 149, 193
MaeI CTAG 1 cut(s) 292
MaeIII GTNAC 1 cut(s) 88
MhlI GDGCHC 1 cut(s) 116
MmeI TCCRAC 1 cut(s) 84
MnlI CCTC 6 cut(s) 61, 76, 118, 203, 230, 294
MspR9I CCNGG 1 cut(s) 122
MvaI CCWGG 1 cut(s) 122
MwoI GCNNNNNNNGC 1 cut(s) 178
NlaIII CATG 3 cut(s) 96, 120, 162
NmuCI GTSAC 1 cut(s) 88
NspI RCATGY 2 cut(s) 96, 162
PkrI GCNGC 3 cut(s) 164, 183, 272
Psp6I CCWGG 1 cut(s) 120
PspFI CCCAGC 1 cut(s) 214
PspGI CCWGG 1 cut(s) 120
SatI GCNGC 3 cut(s) 163, 182, 271
ScrFI CCNGG 1 cut(s) 122
SduI GDGCHC 1 cut(s) 116
SetI ASST 7 cut(s) 9, 19, 72, 137, 151, 174, 190
SmlI CTYRAG 1 cut(s) 221
SmoI CTYRAG 1 cut(s) 221
SsiI CCGC 2 cut(s) 44, 270
SspMI CTAG 1 cut(s) 292
StyD4I CCNGG 1 cut(s) 120
TauI GCSGC 1 cut(s) 273
TscAI CASTG 1 cut(s) 93
TseFI GTSAC 1 cut(s) 88
TseI GCWGC 2 cut(s) 162, 181
Tsp45I GTSAC 1 cut(s) 88
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 90
TspRI CASTG 1 cut(s) 93
XceI RCATGY 2 cut(s) 96, 162
XspI CTAG 1 cut(s) 292
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.