MD17G1250700.v1.1

Nuclear transcription factor Y subunit

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
30033136 .. 30033498
363 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1250700.v1.1.491

Sequence Viewer

Length: 255 bp
ATGGATTTGAACCATTCTATCAATTTCTCATCTTCTTCGAGCACTTCTTCCCCAGTCGATGATTTCATGCCATTGGATTCTTTCATGCTGCCCGATTGCGACCCTCATCTTTCTACCAAAGAGGAGGAAGATCATGAGGCGAGACGCTCTAGTTTTACTCAACTGCAGAAGGAAAATATAGATCTATTTTGGAATCAACAGTTGTTCGAGATTCAAAATACACCAGGTTCTTATTTTGTTGTTGTCTATAACTAG

Protein Analysis

85

Amino Acids

9.74

Weight (kDa)

4.24

Isoelectric Point (pI)

71.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016821)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 10, 215
AjnI CCWGG 1 cut(s) 223
Alw21I GWGCWC 1 cut(s) 44
Alw26I GTCTC 1 cut(s) 136
ApeKI GCWGC 1 cut(s) 88
Bbv12I GWGCWC 1 cut(s) 44
BbvI GCAGC 1 cut(s) 75
BciT130I CCWGG 1 cut(s) 225
BcoDI GTCTC 1 cut(s) 136
BfaI CTAG 2 cut(s) 150, 253
BfmI CTRYAG 1 cut(s) 164
BglII AGATCT 1 cut(s) 181
BisI GCNGC 1 cut(s) 89
BlsI GCNGC 1 cut(s) 90
Bme1390I CCNGG 1 cut(s) 225
BmrFI CCNGG 1 cut(s) 225
BmrI ACTGGG 1 cut(s) 47
BmuI ACTGGG 1 cut(s) 47
Bse1I ACTGG 1 cut(s) 53
BseBI CCWGG 1 cut(s) 225
BseNI ACTGG 1 cut(s) 53
BseRI GAGGAG 1 cut(s) 137
BseXI GCAGC 1 cut(s) 75
BsiHKAI GWGCWC 1 cut(s) 44
BsmAI GTCTC 1 cut(s) 136
BsmBI CGTCTC 1 cut(s) 136
Bsp1286I GDGCHC 1 cut(s) 44
Bsp143I GATC 2 cut(s) 130, 181
BspHI TCATGA 1 cut(s) 133
BspMAI CTGCAG 1 cut(s) 168
BsrI ACTGG 1 cut(s) 53
BssMI GATC 2 cut(s) 130, 181
Bst2UI CCWGG 1 cut(s) 225
Bst4CI ACNGT 1 cut(s) 201
BstKTI GATC 2 cut(s) 133, 184
BstMAI GTCTC 1 cut(s) 136
BstMBI GATC 2 cut(s) 130, 181
BstNI CCWGG 1 cut(s) 225
BstSCI CCNGG 1 cut(s) 223
BstSFI CTRYAG 1 cut(s) 164
BstV1I GCAGC 1 cut(s) 75
BstX2I RGATCY 1 cut(s) 181
BstYI RGATCY 1 cut(s) 181
CciI TCATGA 1 cut(s) 133
CseI GACGC 1 cut(s) 153
CsiI ACCWGGT 1 cut(s) 223
CviAII CATG 3 cut(s) 67, 85, 134
DpnI GATC 2 cut(s) 132, 183
DpnII GATC 2 cut(s) 130, 181
EcoRII CCWGG 1 cut(s) 223
Esp3I CGTCTC 1 cut(s) 136
FaeI CATG 3 cut(s) 70, 88, 137
FaiI YATR 5 cut(s) 68, 86, 135, 179, 249
FatI CATG 3 cut(s) 66, 84, 133
Fnu4HI GCNGC 1 cut(s) 89
Fsp4HI GCNGC 1 cut(s) 89
FspBI CTAG 2 cut(s) 150, 253
GluI GCNGC 1 cut(s) 89
HgaI GACGC 1 cut(s) 153
Hin1II CATG 3 cut(s) 70, 88, 137
HinfI GANTC 3 cut(s) 77, 193, 211
Hpy188III TCNNGA 2 cut(s) 134, 208
HpyAV CCTTC 1 cut(s) 163
HpyCH4III ACNGT 1 cut(s) 201
HpyCH4V TGCA 1 cut(s) 166
Hsp92II CATG 3 cut(s) 70, 88, 137
Kzo9I GATC 2 cut(s) 130, 181
LpnPI CCDG 3 cut(s) 66, 210, 237
Lsp1109I GCAGC 1 cut(s) 75
MabI ACCWGGT 1 cut(s) 223
MaeI CTAG 2 cut(s) 150, 253
MalI GATC 2 cut(s) 132, 183
MboI GATC 2 cut(s) 130, 181
MboII GAAGA 4 cut(s) 24, 27, 39, 140
MflI RGATCY 1 cut(s) 181
MhlI GDGCHC 1 cut(s) 44
MluCI AATT 1 cut(s) 22
MnlI CCTC 4 cut(s) 114, 115, 118, 130
MspR9I CCNGG 1 cut(s) 225
MvaI CCWGG 1 cut(s) 225
NdeII GATC 2 cut(s) 130, 181
NlaIII CATG 3 cut(s) 70, 88, 137
PagI TCATGA 1 cut(s) 133
PfeI GAWTC 3 cut(s) 77, 193, 211
PkrI GCNGC 1 cut(s) 90
Psp6I CCWGG 1 cut(s) 223
PspGI CCWGG 1 cut(s) 223
PstI CTGCAG 1 cut(s) 168
PsuI RGATCY 1 cut(s) 181
SatI GCNGC 1 cut(s) 89
Sau3AI GATC 2 cut(s) 130, 181
ScrFI CCNGG 1 cut(s) 225
SduI GDGCHC 1 cut(s) 44
SetI ASST 1 cut(s) 229
SexAI ACCWGGT 1 cut(s) 223
SfcI CTRYAG 1 cut(s) 164
Sse9I AATT 1 cut(s) 22
SspMI CTAG 2 cut(s) 150, 253
StyD4I CCNGG 1 cut(s) 223
TaaI ACNGT 1 cut(s) 201
TaqI TCGA 3 cut(s) 38, 57, 207
TasI AATT 1 cut(s) 22
TfiI GAWTC 3 cut(s) 77, 193, 211
TseI GCWGC 1 cut(s) 88
TspDTI ATGAA 2 cut(s) 55, 73
XspI CTAG 2 cut(s) 150, 253
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.