Prupe.1G137200_v2.0.a1

Belongs to the eukaryotic ribosomal protein eS21 family

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
10754494 .. 10756194
1701 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G137200.1

Sequence Viewer

Length: 246 bp
ATGCAGAACGAGGAGGGACAAATCACTGAGCTTTACATTCCCAGGAAATGCTCGGCCACAAACAGGCTGATCACTTCAAAGGACCACGCGTCCGTTCAGATTAACATTGGGCATCTGGACGAGAATGGCATCTACACTGGCCAGTTCTCCACTTTCGCCCTCTGTGGCTATGTCCGCGCTCAGGGAGAGGCTGACAGTGGTCTGGACCGTCTCTGGCAGAAGAAGAAATCTGAAGTTAAACAGTAG

Protein Analysis

82

Amino Acids

9.12

Weight (kDa)

6.71

Isoelectric Point (pI)

19.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 89, 177
AciI CCGC 1 cut(s) 175
AcoI YGGCCR 2 cut(s) 54, 139
AfiI CCNNNNNNNGG 2 cut(s) 63, 181
AflIII ACRYGT 1 cut(s) 87
AgsI TTSAA 1 cut(s) 78
AhdI GACNNNNNGTC 1 cut(s) 88
AjnI CCWGG 1 cut(s) 41
AluBI AGCT 1 cut(s) 31
AluI AGCT 1 cut(s) 31
Alw26I GTCTC 1 cut(s) 215
AoxI GGCC 2 cut(s) 54, 139
AspLEI GCGC 1 cut(s) 179
AspS9I GGNCC 2 cut(s) 82, 205
AvaII GGWCC 2 cut(s) 82, 205
BalI TGGCCA 1 cut(s) 141
BciT130I CCWGG 1 cut(s) 43
BclI TGATCA 1 cut(s) 69
BcoDI GTCTC 1 cut(s) 215
Bme1390I CCNGG 1 cut(s) 43
Bme18I GGWCC 2 cut(s) 82, 205
BmeRI GACNNNNNGTC 1 cut(s) 88
BmgT120I GGNCC 2 cut(s) 82, 205
BmrFI CCNGG 1 cut(s) 43
BmsI GCATC 2 cut(s) 121, 138
BoxI GACNNNNGTC 1 cut(s) 198
Bpu10I CCTNAGC 1 cut(s) 180
BsaJI CCNNGG 1 cut(s) 41
Bsc4I CCNNNNNNNGG 2 cut(s) 63, 181
Bse1I ACTGG 2 cut(s) 142, 142
BseBI CCWGG 1 cut(s) 43
BseDI CCNNGG 1 cut(s) 41
BseLI CCNNNNNNNGG 2 cut(s) 63, 181
BseMII CTCAG 2 cut(s) 18, 194
BseNI ACTGG 2 cut(s) 142, 142
BseRI GAGGAG 1 cut(s) 26
Bsh1236I CGCG 2 cut(s) 89, 177
BshFI GGCC 2 cut(s) 56, 141
BslFI GGGAC 1 cut(s) 30
BslI CCNNNNNNNGG 2 cut(s) 63, 181
BsmAI GTCTC 1 cut(s) 215
BsmBI CGTCTC 1 cut(s) 215
BsmFI GGGAC 1 cut(s) 30
BsnI GGCC 2 cut(s) 56, 141
Bsp143I GATC 1 cut(s) 69
BspACI CCGC 1 cut(s) 175
BspANI GGCC 2 cut(s) 56, 141
BspCNI CTCAG 2 cut(s) 19, 193
BspFNI CGCG 2 cut(s) 89, 177
BsrI ACTGG 2 cut(s) 142, 142
BssECI CCNNGG 1 cut(s) 41
BssMI GATC 1 cut(s) 69
Bst2UI CCWGG 1 cut(s) 43
Bst4CI ACNGT 3 cut(s) 197, 209, 243
BstDEI CTNAG 2 cut(s) 27, 180
BstFNI CGCG 2 cut(s) 89, 177
BstHHI GCGC 1 cut(s) 179
BstKTI GATC 1 cut(s) 72
BstMAI GTCTC 1 cut(s) 215
BstMBI GATC 1 cut(s) 69
BstMWI GCNNNNNNNGC 1 cut(s) 174
BstNI CCWGG 1 cut(s) 43
BstPAI GACNNNNGTC 1 cut(s) 198
BstSCI CCNGG 1 cut(s) 41
BstUI CGCG 2 cut(s) 89, 177
BsuRI GGCC 2 cut(s) 56, 141
BtsIMutI CAGTG 3 cut(s) 24, 135, 202
CfoI GCGC 1 cut(s) 179
Cfr13I GGNCC 2 cut(s) 82, 205
CseI GACGC 1 cut(s) 78
CviJI RGCY 6 cut(s) 31, 56, 67, 141, 168, 191
CviKI_1 RGCY 6 cut(s) 31, 56, 67, 141, 168, 191
DdeI CTNAG 2 cut(s) 27, 180
DpnI GATC 1 cut(s) 71
DpnII GATC 1 cut(s) 69
DriI GACNNNNNGTC 1 cut(s) 88
EaeI YGGCCR 2 cut(s) 54, 139
Eam1105I GACNNNNNGTC 1 cut(s) 88
Eco47I GGWCC 2 cut(s) 82, 205
EcoRII CCWGG 1 cut(s) 41
Esp3I CGTCTC 1 cut(s) 215
FaiI YATR 1 cut(s) 171
FaqI GGGAC 1 cut(s) 30
FbaI TGATCA 1 cut(s) 69
GlaI GCGC 1 cut(s) 178
HaeIII GGCC 2 cut(s) 56, 141
HgaI GACGC 1 cut(s) 78
HhaI GCGC 1 cut(s) 179
Hin6I GCGC 1 cut(s) 177
HinP1I GCGC 1 cut(s) 177
Hpy188I TCNGA 2 cut(s) 99, 232
Hpy188III TCNNGA 2 cut(s) 116, 203
HpyCH4III ACNGT 3 cut(s) 197, 209, 243
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 174
HpyF3I CTNAG 2 cut(s) 27, 180
HspAI GCGC 1 cut(s) 177
Ksp22I TGATCA 1 cut(s) 69
Kzo9I GATC 1 cut(s) 69
LpnPI CCDG 9 cut(s) 28, 49, 55, 101, 123, 155, 167, 188, 199
LweI GCATC 2 cut(s) 121, 138
MalI GATC 1 cut(s) 71
MboI GATC 1 cut(s) 69
MboII GAAGA 2 cut(s) 232, 235
MlsI TGGCCA 1 cut(s) 141
MluI ACGCGT 1 cut(s) 87
MluNI TGGCCA 1 cut(s) 141
MnlI CCTC 4 cut(s) 4, 7, 170, 181
Mox20I TGGCCA 1 cut(s) 141
MscI TGGCCA 1 cut(s) 141
MseI TTAA 2 cut(s) 102, 237
Msp20I TGGCCA 1 cut(s) 141
MspR9I CCNGG 1 cut(s) 43
MvaI CCWGG 1 cut(s) 43
MvnI CGCG 2 cut(s) 89, 177
MwoI GCNNNNNNNGC 1 cut(s) 174
NdeII GATC 1 cut(s) 69
NmeAIII GCCGAG 1 cut(s) 32
PshAI GACNNNNGTC 1 cut(s) 198
Psp6I CCWGG 1 cut(s) 41
PspGI CCWGG 1 cut(s) 41
PspPI GGNCC 2 cut(s) 82, 205
SaqAI TTAA 2 cut(s) 102, 237
Sau3AI GATC 1 cut(s) 69
Sau96I GGNCC 2 cut(s) 82, 205
ScrFI CCNGG 1 cut(s) 43
SetI ASST 1 cut(s) 33
SfaNI GCATC 2 cut(s) 121, 138
SinI GGWCC 2 cut(s) 82, 205
SsiI CCGC 1 cut(s) 175
StyD4I CCNGG 1 cut(s) 41
TaaI ACNGT 3 cut(s) 197, 209, 243
Tru1I TTAA 2 cut(s) 102, 237
Tru9I TTAA 2 cut(s) 102, 237
TscAI CASTG 3 cut(s) 31, 142, 202
TspGWI ACGGA 1 cut(s) 82
TspRI CASTG 3 cut(s) 31, 142, 202
VpaK11BI GGWCC 2 cut(s) 82, 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.