Prupe.2G010100_v2.0.a1

U6 snRNA-associated Sm-like protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Forward (+)
935637 .. 939446
3810 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G010100.1

Sequence Viewer

Length: 300 bp
ATGTCAGGGAGGAAAGAAACAGTCTTGGACCTGGCCAAGTTTGTGGACAAAGGTGTCCAAGTCAAGCTCACTGGTGGTAGACAAGTAACAGGGACTCTAAAAGGATATGACCAGTTGTTAAACCTTGTCCTAGACGAAGCAGTAGAGTTTCTAAGAGATTCTGATGATCCATTGAAGACTACGGACCAGACCAGGCGCCTTGGCCTAATAGTTTGTAGGGGAACTGCTGTAATGCTTGTGTCGCCAACAGATGGTACAGATGAGATTGCGAACCCTTTTAGCCAGCCTGATGGGGCCTAA

Protein Analysis

100

Amino Acids

10.71

Weight (kDa)

4.79

Isoelectric Point (pI)

23.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 53
AccB1I GGYRCC 1 cut(s) 195
AccB7I CCANNNNNTGG 1 cut(s) 251
AccI GTMKAC 1 cut(s) 79
AclWI GGATC 1 cut(s) 161
AcoI YGGCCR 1 cut(s) 33
AcyI GRCGYC 1 cut(s) 196
AfaI GTAC 1 cut(s) 256
AfiI CCNNNNNNNGG 1 cut(s) 251
AgsI TTSAA 1 cut(s) 175
AjnI CCWGG 2 cut(s) 30, 191
AluBI AGCT 1 cut(s) 67
AluI AGCT 1 cut(s) 67
AlwI GGATC 1 cut(s) 161
AoxI GGCC 3 cut(s) 33, 202, 294
AspLEI GCGC 1 cut(s) 198
AspS9I GGNCC 3 cut(s) 28, 184, 294
AvaII GGWCC 2 cut(s) 28, 184
BalI TGGCCA 1 cut(s) 35
BanI GGYRCC 1 cut(s) 195
BbsI GAAGAC 1 cut(s) 182
BccI CCATC 2 cut(s) 245, 284
BciT130I CCWGG 2 cut(s) 32, 193
BfaI CTAG 1 cut(s) 131
BfoI RGCGCY 1 cut(s) 199
Bme1390I CCNGG 2 cut(s) 32, 193
Bme18I GGWCC 2 cut(s) 28, 184
BmgT120I GGNCC 3 cut(s) 28, 184, 294
BmiI GGNNCC 2 cut(s) 197, 295
BmrFI CCNGG 2 cut(s) 32, 193
BpiI GAAGAC 1 cut(s) 182
BsaHI GRCGYC 1 cut(s) 196
BsaJI CCNNGG 1 cut(s) 199
Bsc4I CCNNNNNNNGG 1 cut(s) 251
Bse1I ACTGG 2 cut(s) 76, 112
BseBI CCWGG 2 cut(s) 32, 193
BseDI CCNNGG 1 cut(s) 199
BseLI CCNNNNNNNGG 1 cut(s) 251
BseNI ACTGG 2 cut(s) 76, 112
BshFI GGCC 3 cut(s) 35, 204, 296
BshNI GGYRCC 1 cut(s) 195
BslFI GGGAC 1 cut(s) 106
BslI CCNNNNNNNGG 1 cut(s) 251
BsmFI GGGAC 1 cut(s) 106
BsnI GGCC 3 cut(s) 35, 204, 296
Bsp143I GATC 1 cut(s) 166
BspANI GGCC 3 cut(s) 35, 204, 296
BspLI GGNNCC 2 cut(s) 197, 295
BspPI GGATC 1 cut(s) 161
BspT107I GGYRCC 1 cut(s) 195
BsrI ACTGG 2 cut(s) 76, 112
BssECI CCNNGG 1 cut(s) 199
BssMI GATC 1 cut(s) 166
BssNI GRCGYC 1 cut(s) 196
BssT1I CCWWGG 1 cut(s) 199
Bst2UI CCWGG 2 cut(s) 32, 193
Bst4CI ACNGT 1 cut(s) 22
BstACI GRCGYC 1 cut(s) 196
BstC8I GCNNGC 1 cut(s) 284
BstDEI CTNAG 1 cut(s) 152
BstH2I RGCGCY 1 cut(s) 199
BstHHI GCGC 1 cut(s) 198
BstKTI GATC 1 cut(s) 169
BstMBI GATC 1 cut(s) 166
BstMWI GCNNNNNNNGC 1 cut(s) 241
BstNI CCWGG 2 cut(s) 32, 193
BstSCI CCNGG 2 cut(s) 30, 191
BstV2I GAAGAC 1 cut(s) 182
BstXI CCANNNNNNTGG 2 cut(s) 43, 290
BsuRI GGCC 3 cut(s) 35, 204, 296
BtsIMutI CAGTG 1 cut(s) 69
Cac8I GCNNGC 1 cut(s) 284
CfoI GCGC 1 cut(s) 198
Cfr13I GGNCC 3 cut(s) 28, 184, 294
Csp6I GTAC 1 cut(s) 255
CviJI RGCY 6 cut(s) 35, 67, 204, 282, 286, 296
CviKI_1 RGCY 6 cut(s) 35, 67, 204, 282, 286, 296
CviQI GTAC 1 cut(s) 255
DdeI CTNAG 1 cut(s) 152
DinI GGCGCC 1 cut(s) 197
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
DrdI GACNNNNNNGTC 1 cut(s) 53
DseDI GACNNNNNNGTC 1 cut(s) 53
EaeI YGGCCR 1 cut(s) 33
Eco130I CCWWGG 1 cut(s) 199
Eco47I GGWCC 2 cut(s) 28, 184
EcoO109I RGGNCCY 1 cut(s) 294
EcoRII CCWGG 2 cut(s) 30, 191
EcoT14I CCWWGG 1 cut(s) 199
EgeI GGCGCC 1 cut(s) 197
EheI GGCGCC 1 cut(s) 197
ErhI CCWWGG 1 cut(s) 199
FaiI YATR 1 cut(s) 108
FaqI GGGAC 1 cut(s) 106
FblI GTMKAC 1 cut(s) 79
FspBI CTAG 1 cut(s) 131
GlaI GCGC 1 cut(s) 197
HaeII RGCGCY 1 cut(s) 199
HaeIII GGCC 3 cut(s) 35, 204, 296
HhaI GCGC 1 cut(s) 198
Hin1I GRCGYC 1 cut(s) 196
Hin6I GCGC 1 cut(s) 196
HinP1I GCGC 1 cut(s) 196
HinfI GANTC 2 cut(s) 94, 158
Hpy166II GTNNAC 2 cut(s) 46, 80
Hpy188I TCNGA 1 cut(s) 163
Hpy8I GTNNAC 2 cut(s) 46, 80
HpyCH4III ACNGT 1 cut(s) 22
HpyF10VI GCNNNNNNNGC 1 cut(s) 241
HpyF3I CTNAG 1 cut(s) 152
Hsp92I GRCGYC 1 cut(s) 196
HspAI GCGC 1 cut(s) 196
KasI GGCGCC 1 cut(s) 195
Kzo9I GATC 1 cut(s) 166
LpnPI CCDG 9 cut(s) 17, 44, 57, 75, 125, 178, 200, 205, 296
MaeI CTAG 1 cut(s) 131
MaeIII GTNAC 1 cut(s) 85
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MboII GAAGA 1 cut(s) 187
MlsI TGGCCA 1 cut(s) 35
MluNI TGGCCA 1 cut(s) 35
Mly113I GGCGCC 1 cut(s) 196
MlyI GAGTC 1 cut(s) 88
MnlI CCTC 1 cut(s) 3
Mox20I TGGCCA 1 cut(s) 35
MscI TGGCCA 1 cut(s) 35
MseI TTAA 1 cut(s) 119
Msp20I TGGCCA 1 cut(s) 35
MspR9I CCNGG 2 cut(s) 32, 193
MvaI CCWGG 2 cut(s) 32, 193
MwoI GCNNNNNNNGC 1 cut(s) 241
NarI GGCGCC 1 cut(s) 196
NdeII GATC 1 cut(s) 166
NlaIV GGNNCC 2 cut(s) 197, 295
PfeI GAWTC 1 cut(s) 158
PflMI CCANNNNNTGG 1 cut(s) 251
PleI GAGTC 1 cut(s) 88
PluTI GGCGCC 1 cut(s) 199
PpsI GAGTC 1 cut(s) 88
Psp6I CCWGG 2 cut(s) 30, 191
PspGI CCWGG 2 cut(s) 30, 191
PspN4I GGNNCC 2 cut(s) 197, 295
PspPI GGNCC 3 cut(s) 28, 184, 294
RsaI GTAC 1 cut(s) 256
RsaNI GTAC 1 cut(s) 255
SaqAI TTAA 1 cut(s) 119
Sau3AI GATC 1 cut(s) 166
Sau96I GGNCC 3 cut(s) 28, 184, 294
SchI GAGTC 1 cut(s) 88
ScrFI CCNGG 2 cut(s) 32, 193
SetI ASST 4 cut(s) 33, 55, 69, 126
SfoI GGCGCC 1 cut(s) 197
SinI GGWCC 2 cut(s) 28, 184
SspDI GGCGCC 1 cut(s) 195
SspMI CTAG 1 cut(s) 131
StyD4I CCNGG 2 cut(s) 30, 191
StyI CCWWGG 1 cut(s) 199
TaaI ACNGT 1 cut(s) 22
TfiI GAWTC 1 cut(s) 158
Tru1I TTAA 1 cut(s) 119
Tru9I TTAA 1 cut(s) 119
TscAI CASTG 1 cut(s) 76
TspGWI ACGGA 1 cut(s) 197
TspRI CASTG 1 cut(s) 76
Van91I CCANNNNNTGG 1 cut(s) 251
VpaK11BI GGWCC 2 cut(s) 28, 184
XmiI GTMKAC 1 cut(s) 79
XspI CTAG 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.