Rh1AG014300

U6 snRNA-associated Sm-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0008526
Physical Location & Seq
Forward (+)
2252168 .. 2256049
3882 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG014300.1

Sequence Viewer

Length: 279 bp
ATGTCAGGGAGGAAAGAAACAGTGTTGGACTTGGCCAAGTTTGTGGACAAAGGTGTCCAAGTCAAGCTCACTGGTGGTAGACAAGTGACAGGGACTCTAAAAGGATATGATCAGTTGTTAAACCTTGTTCTCGATGAAGCAGTTGAATTTCTAAGAGATTCTGATGATCCACTGAAGACTACTGACCAAACCAGGCGCCTTGGCCTAATTGTATGTATTCTTAGCTCGTCTTTAGTCGGACTATATTTGATAGCTATTGAAATAAATCCTACAAACTGA

Protein Analysis

92

Amino Acids

10.09

Weight (kDa)

5.26

Isoelectric Point (pI)

26.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LSM PF01423 10 - 71 4.3e-16 LSM domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 53
AccB1I GGYRCC 1 cut(s) 195
AccI GTMKAC 1 cut(s) 79
AclWI GGATC 1 cut(s) 161
AcoI YGGCCR 1 cut(s) 33
AcsI RAATTY 1 cut(s) 146
AcuI CTGAAG 1 cut(s) 194
AcyI GRCGYC 1 cut(s) 196
AgsI TTSAA 2 cut(s) 146, 260
AjnI CCWGG 1 cut(s) 191
AluBI AGCT 3 cut(s) 67, 225, 254
AluI AGCT 3 cut(s) 67, 225, 254
AlwI GGATC 1 cut(s) 161
AoxI GGCC 2 cut(s) 33, 202
ApoI RAATTY 1 cut(s) 146
AspLEI GCGC 1 cut(s) 198
BalI TGGCCA 1 cut(s) 35
BanI GGYRCC 1 cut(s) 195
BbsI GAAGAC 1 cut(s) 182
BciT130I CCWGG 1 cut(s) 193
BclI TGATCA 1 cut(s) 109
BfoI RGCGCY 1 cut(s) 199
Bme1390I CCNGG 1 cut(s) 193
BmiI GGNNCC 1 cut(s) 197
BmrFI CCNGG 1 cut(s) 193
BpiI GAAGAC 1 cut(s) 182
BsaHI GRCGYC 1 cut(s) 196
BsaJI CCNNGG 1 cut(s) 199
Bse1I ACTGG 1 cut(s) 76
BseBI CCWGG 1 cut(s) 193
BseDI CCNNGG 1 cut(s) 199
BseNI ACTGG 1 cut(s) 76
BshFI GGCC 2 cut(s) 35, 204
BshNI GGYRCC 1 cut(s) 195
BslFI GGGAC 1 cut(s) 106
BsmFI GGGAC 1 cut(s) 106
BsnI GGCC 2 cut(s) 35, 204
Bsp143I GATC 2 cut(s) 109, 166
BspANI GGCC 2 cut(s) 35, 204
BspLI GGNNCC 1 cut(s) 197
BspPI GGATC 1 cut(s) 161
BspT107I GGYRCC 1 cut(s) 195
BsrI ACTGG 1 cut(s) 76
BssECI CCNNGG 1 cut(s) 199
BssMI GATC 2 cut(s) 109, 166
BssNI GRCGYC 1 cut(s) 196
BssT1I CCWWGG 1 cut(s) 199
Bst2UI CCWGG 1 cut(s) 193
Bst4CI ACNGT 1 cut(s) 22
BstACI GRCGYC 1 cut(s) 196
BstDEI CTNAG 2 cut(s) 152, 221
BstH2I RGCGCY 1 cut(s) 199
BstHHI GCGC 1 cut(s) 198
BstKTI GATC 2 cut(s) 112, 169
BstMBI GATC 2 cut(s) 109, 166
BstNI CCWGG 1 cut(s) 193
BstSCI CCNGG 1 cut(s) 191
BstV2I GAAGAC 1 cut(s) 182
BstXI CCANNNNNNTGG 1 cut(s) 43
BsuRI GGCC 2 cut(s) 35, 204
BtsIMutI CAGTG 3 cut(s) 27, 69, 170
CfoI GCGC 1 cut(s) 198
CviJI RGCY 5 cut(s) 35, 67, 204, 225, 254
CviKI_1 RGCY 5 cut(s) 35, 67, 204, 225, 254
DdeI CTNAG 2 cut(s) 152, 221
DinI GGCGCC 1 cut(s) 197
DpnI GATC 2 cut(s) 111, 168
DpnII GATC 2 cut(s) 109, 166
DrdI GACNNNNNNGTC 1 cut(s) 53
DseDI GACNNNNNNGTC 1 cut(s) 53
EaeI YGGCCR 1 cut(s) 33
Eco130I CCWWGG 1 cut(s) 199
Eco57I CTGAAG 1 cut(s) 194
EcoRII CCWGG 1 cut(s) 191
EcoT14I CCWWGG 1 cut(s) 199
EgeI GGCGCC 1 cut(s) 197
EheI GGCGCC 1 cut(s) 197
ErhI CCWWGG 1 cut(s) 199
FaiI YATR 3 cut(s) 108, 214, 244
FaqI GGGAC 1 cut(s) 106
FbaI TGATCA 1 cut(s) 109
FblI GTMKAC 1 cut(s) 79
GlaI GCGC 1 cut(s) 197
HaeII RGCGCY 1 cut(s) 199
HaeIII GGCC 2 cut(s) 35, 204
HhaI GCGC 1 cut(s) 198
Hin1I GRCGYC 1 cut(s) 196
Hin6I GCGC 1 cut(s) 196
HinP1I GCGC 1 cut(s) 196
HinfI GANTC 2 cut(s) 94, 158
Hpy166II GTNNAC 2 cut(s) 46, 80
Hpy188I TCNGA 2 cut(s) 163, 239
Hpy188III TCNNGA 1 cut(s) 131
Hpy8I GTNNAC 2 cut(s) 46, 80
HpyCH4III ACNGT 1 cut(s) 22
HpyF3I CTNAG 2 cut(s) 152, 221
Hsp92I GRCGYC 1 cut(s) 196
HspAI GCGC 1 cut(s) 196
KasI GGCGCC 1 cut(s) 195
Ksp22I TGATCA 1 cut(s) 109
Kzo9I GATC 2 cut(s) 109, 166
LpnPI CCDG 4 cut(s) 57, 75, 178, 205
MaeIII GTNAC 1 cut(s) 85
MalI GATC 2 cut(s) 111, 168
MboI GATC 2 cut(s) 109, 166
MboII GAAGA 1 cut(s) 187
MlsI TGGCCA 1 cut(s) 35
MluCI AATT 2 cut(s) 146, 207
MluNI TGGCCA 1 cut(s) 35
Mly113I GGCGCC 1 cut(s) 196
MlyI GAGTC 1 cut(s) 88
MmeI TCCRAC 2 cut(s) 6, 217
MnlI CCTC 1 cut(s) 3
Mox20I TGGCCA 1 cut(s) 35
MscI TGGCCA 1 cut(s) 35
MseI TTAA 1 cut(s) 119
Msp20I TGGCCA 1 cut(s) 35
MspR9I CCNGG 1 cut(s) 193
MvaI CCWGG 1 cut(s) 193
NarI GGCGCC 1 cut(s) 196
NdeII GATC 2 cut(s) 109, 166
NlaIV GGNNCC 1 cut(s) 197
NmuCI GTSAC 1 cut(s) 85
PfeI GAWTC 1 cut(s) 158
PleI GAGTC 1 cut(s) 88
PluTI GGCGCC 1 cut(s) 199
PpsI GAGTC 1 cut(s) 88
Psp6I CCWGG 1 cut(s) 191
PspGI CCWGG 1 cut(s) 191
PspN4I GGNNCC 1 cut(s) 197
SaqAI TTAA 1 cut(s) 119
Sau3AI GATC 2 cut(s) 109, 166
SchI GAGTC 1 cut(s) 88
ScrFI CCNGG 1 cut(s) 193
SetI ASST 5 cut(s) 55, 69, 126, 227, 256
SfoI GGCGCC 1 cut(s) 197
Sse9I AATT 2 cut(s) 146, 207
SspDI GGCGCC 1 cut(s) 195
StyD4I CCNGG 1 cut(s) 191
StyI CCWWGG 1 cut(s) 199
TaaI ACNGT 1 cut(s) 22
TaqI TCGA 1 cut(s) 132
TasI AATT 2 cut(s) 146, 207
TfiI GAWTC 1 cut(s) 158
Tru1I TTAA 1 cut(s) 119
Tru9I TTAA 1 cut(s) 119
TscAI CASTG 3 cut(s) 27, 76, 177
TseFI GTSAC 1 cut(s) 85
Tsp45I GTSAC 1 cut(s) 85
TspDTI ATGAA 1 cut(s) 150
TspRI CASTG 3 cut(s) 27, 76, 177
XapI RAATTY 1 cut(s) 146
XmiI GTMKAC 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.