Prupe.2G184300_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Forward (+)
22598671 .. 22599392
722 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G184300.1

Sequence Viewer

Length: 423 bp
ATGCAAGAAACATTGAAACGCAGAGAAGAAGATCATCAGAAAGAAGAGGCAGAATTGGGCGTATGGGATTGTGGCAGCCCCTTATATGACTCCTATGAATTGGTCACAGTCAGTCACCTGATCGAACGGCATCTAATGGCATTGCCATCTCTAGGAAGATCAAGGCGGTTCATCACCAATCTCTCTCATCTTCCATCATCAGAGATGGCCTCCTTGAGTGCCACTACCATATCATCAAGGGAGGGCAAAGGGTCATCTTCTTCTTCCATGGTGGGTGGCTTGAGTGAATTTATGGGGATTAGGGAGATTTGGAAGAGGAGGGTTGTGTTTGGAGGAAGAAAAGACAAGGCCAAGAAAATGAAAACAGGGTTGTCTGGCTTTTGCAATTTGATTGATCTATGGAGGCAAAAGGATCACAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

141

Amino Acids

15.9

Weight (kDa)

9.42

Isoelectric Point (pI)

70.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014270)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 166
AclWI GGATC 1 cut(s) 420
AcsI RAATTY 1 cut(s) 287
AfiI CCNNNNNNNGG 1 cut(s) 152
AgsI TTSAA 1 cut(s) 16
AlwI GGATC 1 cut(s) 420
AoxI GGCC 2 cut(s) 207, 348
ApeKI GCWGC 1 cut(s) 75
ApoI RAATTY 1 cut(s) 287
AsuHPI GGTGA 2 cut(s) 107, 166
BbvI GCAGC 1 cut(s) 87
BccI CCATC 3 cut(s) 154, 199, 202
BceAI ACGGC 1 cut(s) 143
BfaI CTAG 1 cut(s) 152
BisI GCNGC 1 cut(s) 76
BlsI GCNGC 1 cut(s) 77
BmsI GCATC 1 cut(s) 139
BplI GAGNNNNNCTC 2 cut(s) 194, 226
BpuEI CTTGAG 2 cut(s) 235, 301
BsaJI CCNNGG 1 cut(s) 267
Bsc4I CCNNNNNNNGG 1 cut(s) 152
Bse3DI GCAATG 1 cut(s) 140
BseDI CCNNGG 1 cut(s) 267
BseLI CCNNNNNNNGG 1 cut(s) 152
BseMI GCAATG 1 cut(s) 140
BseRI GAGGAG 1 cut(s) 331
BseXI GCAGC 1 cut(s) 87
BshFI GGCC 2 cut(s) 209, 350
BslI CCNNNNNNNGG 1 cut(s) 152
BsnI GGCC 2 cut(s) 209, 350
Bsp143I GATC 5 cut(s) 31, 120, 158, 394, 412
Bsp19I CCATGG 1 cut(s) 267
BspACI CCGC 1 cut(s) 166
BspANI GGCC 2 cut(s) 209, 350
BspPI GGATC 1 cut(s) 420
BsrDI GCAATG 1 cut(s) 140
BssECI CCNNGG 1 cut(s) 267
BssMI GATC 5 cut(s) 31, 120, 158, 394, 412
BssT1I CCWWGG 1 cut(s) 267
Bst4CI ACNGT 1 cut(s) 109
Bst6I CTCTTC 2 cut(s) 39, 308
BstDSI CCRYGG 1 cut(s) 267
BstKTI GATC 5 cut(s) 34, 123, 161, 397, 415
BstMBI GATC 5 cut(s) 31, 120, 158, 394, 412
BstV1I GCAGC 1 cut(s) 87
BsuRI GGCC 2 cut(s) 209, 350
BtgI CCRYGG 1 cut(s) 267
CviAII CATG 1 cut(s) 268
CviJI RGCY 5 cut(s) 78, 209, 279, 350, 378
CviKI_1 RGCY 5 cut(s) 78, 209, 279, 350, 378
DpnI GATC 5 cut(s) 33, 122, 160, 396, 414
DpnII GATC 5 cut(s) 31, 120, 158, 394, 412
Eam1104I CTCTTC 2 cut(s) 39, 308
EarI CTCTTC 2 cut(s) 39, 308
Eco130I CCWWGG 1 cut(s) 267
EcoT14I CCWWGG 1 cut(s) 267
ErhI CCWWGG 1 cut(s) 267
FaeI CATG 1 cut(s) 271
FaiI YATR 8 cut(s) 64, 85, 87, 96, 230, 269, 293, 400
FatI CATG 1 cut(s) 267
Fnu4HI GCNGC 1 cut(s) 76
Fsp4HI GCNGC 1 cut(s) 76
FspBI CTAG 1 cut(s) 152
GluI GCNGC 1 cut(s) 76
HaeIII GGCC 2 cut(s) 209, 350
Hin1II CATG 1 cut(s) 271
HinfI GANTC 1 cut(s) 89
HphI GGTGA 2 cut(s) 107, 166
Hpy188I TCNGA 2 cut(s) 39, 202
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4V TGCA 2 cut(s) 4, 384
Hsp92II CATG 1 cut(s) 271
Kzo9I GATC 5 cut(s) 31, 120, 158, 394, 412
LpnPI CCDG 4 cut(s) 131, 351, 360, 403
Lsp1109I GCAGC 1 cut(s) 87
LweI GCATC 1 cut(s) 139
MaeI CTAG 1 cut(s) 152
MaeIII GTNAC 2 cut(s) 103, 113
MalI GATC 5 cut(s) 33, 122, 160, 396, 414
MboI GATC 5 cut(s) 31, 120, 158, 394, 412
MluCI AATT 4 cut(s) 53, 98, 287, 385
MlyI GAGTC 1 cut(s) 83
MnlI CCTC 7 cut(s) 40, 220, 235, 309, 312, 326, 396
NcoI CCATGG 1 cut(s) 267
NdeII GATC 5 cut(s) 31, 120, 158, 394, 412
NlaIII CATG 1 cut(s) 271
NmuCI GTSAC 2 cut(s) 103, 113
PkrI GCNGC 1 cut(s) 77
PleI GAGTC 1 cut(s) 83
PpsI GAGTC 1 cut(s) 83
SatI GCNGC 1 cut(s) 76
Sau3AI GATC 5 cut(s) 31, 120, 158, 394, 412
SchI GAGTC 1 cut(s) 83
SetI ASST 2 cut(s) 120, 422
SfaNI GCATC 1 cut(s) 139
SmlI CTYRAG 2 cut(s) 214, 280
SmoI CTYRAG 2 cut(s) 214, 280
Sse9I AATT 4 cut(s) 53, 98, 287, 385
SsiI CCGC 1 cut(s) 166
SspMI CTAG 1 cut(s) 152
StyI CCWWGG 1 cut(s) 267
TaaI ACNGT 1 cut(s) 109
TaqI TCGA 1 cut(s) 123
TasI AATT 4 cut(s) 53, 98, 287, 385
TseFI GTSAC 2 cut(s) 103, 113
TseI GCWGC 1 cut(s) 75
Tsp45I GTSAC 2 cut(s) 103, 113
TspDTI ATGAA 3 cut(s) 111, 160, 374
XapI RAATTY 1 cut(s) 287
XspI CTAG 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.