Prupe.3G125300_v2.0.a1

DNA-directed RNA polymerases I and III subunit

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Reverse (-)
11524698 .. 11527263
2566 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G125300.1

Sequence Viewer

Length: 324 bp
ATGGAACATGGGTCCTTATCTGATCCCAGCCAATCCACATTTTCTTTGATTGATGAGGATCATACATATGCGAATGCGATCAGGTTCACTTTAAATCAGGATCCAAGGACAAAATTTTGTGGGTACAGCATTCCTCATCCATCCGATAACCGAGTTAATATTAGAGTCCAAACAACAGGTGCTGCAGCGAAAGAAGTATTCAAAGATGCAAGCCAGGATCTCATGGTTGTATGCCAACATGTGAGGAGCACCTTTGACAAGGCTGTCGTTGATTTTAGAATGAGCAAATCCGTGAATGGCATGGATATTGACTCAAATAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

11.96

Weight (kDa)

5.69

Isoelectric Point (pI)

33.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 263
AclWI GGATC 5 cut(s) 17, 66, 95, 108, 225
AcsI RAATTY 1 cut(s) 113
AfaI GTAC 1 cut(s) 125
AflIII ACRYGT 1 cut(s) 238
AgsI TTSAA 1 cut(s) 202
AjnI CCWGG 1 cut(s) 213
Alw21I GWGCWC 1 cut(s) 251
AlwI GGATC 5 cut(s) 17, 66, 95, 108, 225
AlwNI CAGNNNCTG 1 cut(s) 182
ApeKI GCWGC 2 cut(s) 182, 185
ApoI RAATTY 1 cut(s) 113
AspS9I GGNCC 1 cut(s) 12
AvaII GGWCC 1 cut(s) 12
BamHI GGATCC 1 cut(s) 100
Bbv12I GWGCWC 1 cut(s) 251
BbvI GCAGC 2 cut(s) 169, 197
BccI CCATC 1 cut(s) 148
BciT130I CCWGG 1 cut(s) 215
BfmI CTRYAG 1 cut(s) 183
BisI GCNGC 2 cut(s) 183, 186
BlsI GCNGC 2 cut(s) 184, 187
Bme1390I CCNGG 1 cut(s) 215
Bme18I GGWCC 1 cut(s) 12
BmgT120I GGNCC 1 cut(s) 12
BmiI GGNNCC 2 cut(s) 13, 102
BmrFI CCNGG 1 cut(s) 215
BmsI GCATC 1 cut(s) 196
BsaBI GATNNNNATC 1 cut(s) 57
BsaJI CCNNGG 1 cut(s) 104
Bse8I GATNNNNATC 1 cut(s) 57
BseBI CCWGG 1 cut(s) 215
BseDI CCNNGG 1 cut(s) 104
BseGI GGATG 2 cut(s) 136, 140
BseJI GATNNNNATC 1 cut(s) 57
BseRI GAGGAG 1 cut(s) 259
BseXI GCAGC 2 cut(s) 169, 197
BseYI CCCAGC 1 cut(s) 26
BsiHKAI GWGCWC 1 cut(s) 251
BsmI GAATGC 2 cut(s) 79, 129
Bsp1286I GDGCHC 1 cut(s) 251
Bsp143I GATC 5 cut(s) 22, 58, 78, 100, 217
BspLI GGNNCC 2 cut(s) 13, 102
BspMAI CTGCAG 1 cut(s) 187
BspPI GGATC 5 cut(s) 17, 66, 95, 108, 225
BssECI CCNNGG 1 cut(s) 104
BssMI GATC 5 cut(s) 22, 58, 78, 100, 217
BssT1I CCWWGG 1 cut(s) 104
Bst2UI CCWGG 1 cut(s) 215
BstC8I GCNNGC 1 cut(s) 211
BstF5I GGATG 2 cut(s) 136, 140
BstKTI GATC 5 cut(s) 25, 61, 81, 103, 220
BstMBI GATC 5 cut(s) 22, 58, 78, 100, 217
BstNI CCWGG 1 cut(s) 215
BstNSI RCATGY 1 cut(s) 242
BstSCI CCNGG 1 cut(s) 213
BstSFI CTRYAG 1 cut(s) 183
BstV1I GCAGC 2 cut(s) 169, 197
BstX2I RGATCY 2 cut(s) 100, 217
BstYI RGATCY 2 cut(s) 100, 217
BtsCI GGATG 2 cut(s) 136, 140
Cac8I GCNNGC 1 cut(s) 211
CaiI CAGNNNCTG 1 cut(s) 182
Cfr13I GGNCC 1 cut(s) 12
Csp6I GTAC 1 cut(s) 124
CviAII CATG 4 cut(s) 8, 223, 239, 301
CviJI RGCY 3 cut(s) 30, 213, 263
CviKI_1 RGCY 3 cut(s) 30, 213, 263
CviQI GTAC 1 cut(s) 124
DpnI GATC 5 cut(s) 24, 60, 80, 102, 219
DpnII GATC 5 cut(s) 22, 58, 78, 100, 217
DraI TTTAAA 1 cut(s) 93
DrdI GACNNNNNNGTC 1 cut(s) 263
DseDI GACNNNNNNGTC 1 cut(s) 263
Eco130I CCWWGG 1 cut(s) 104
Eco47I GGWCC 1 cut(s) 12
EcoO109I RGGNCCY 1 cut(s) 12
EcoRII CCWGG 1 cut(s) 213
EcoT14I CCWWGG 1 cut(s) 104
ErhI CCWWGG 1 cut(s) 104
FaeI CATG 4 cut(s) 11, 226, 242, 304
FaiI YATR 8 cut(s) 9, 63, 67, 69, 224, 232, 240, 302
FatI CATG 4 cut(s) 7, 222, 238, 300
FauNDI CATATG 1 cut(s) 67
Fnu4HI GCNGC 2 cut(s) 183, 186
FokI GGATG 2 cut(s) 123, 127
Fsp4HI GCNGC 2 cut(s) 183, 186
GluI GCNGC 2 cut(s) 183, 186
GsaI CCCAGC 1 cut(s) 30
Hin1II CATG 4 cut(s) 11, 226, 242, 304
HinfI GANTC 2 cut(s) 165, 311
Hpy166II GTNNAC 1 cut(s) 87
Hpy188I TCNGA 2 cut(s) 22, 145
Hpy188III TCNNGA 1 cut(s) 98
Hpy8I GTNNAC 1 cut(s) 87
HpyCH4V TGCA 2 cut(s) 185, 209
Hsp92II CATG 4 cut(s) 11, 226, 242, 304
Kzo9I GATC 5 cut(s) 22, 58, 78, 100, 217
LmnI GCTCC 1 cut(s) 246
LpnPI CCDG 6 cut(s) 40, 67, 83, 162, 200, 227
Lsp1109I GCAGC 2 cut(s) 169, 197
LweI GCATC 1 cut(s) 196
MalI GATC 5 cut(s) 24, 60, 80, 102, 219
MboI GATC 5 cut(s) 22, 58, 78, 100, 217
MflI RGATCY 2 cut(s) 100, 217
MhlI GDGCHC 1 cut(s) 251
MluCI AATT 2 cut(s) 113, 319
MlyI GAGTC 2 cut(s) 174, 305
MnlI CCTC 3 cut(s) 49, 144, 237
MseI TTAA 3 cut(s) 92, 156, 322
MslI CAYNNNNRTG 1 cut(s) 66
MspR9I CCNGG 1 cut(s) 215
Mva1269I GAATGC 2 cut(s) 79, 129
MvaI CCWGG 1 cut(s) 215
NdeI CATATG 1 cut(s) 67
NdeII GATC 5 cut(s) 22, 58, 78, 100, 217
NlaIII CATG 4 cut(s) 11, 226, 242, 304
NlaIV GGNNCC 2 cut(s) 13, 102
NspI RCATGY 1 cut(s) 242
PciI ACATGT 1 cut(s) 238
PctI GAATGC 2 cut(s) 79, 129
PkrI GCNGC 2 cut(s) 184, 187
PleI GAGTC 2 cut(s) 173, 305
PpsI GAGTC 2 cut(s) 173, 305
PpuMI RGGWCCY 1 cut(s) 12
PscI ACATGT 1 cut(s) 238
Psp5II RGGWCCY 1 cut(s) 12
Psp6I CCWGG 1 cut(s) 213
PspFI CCCAGC 1 cut(s) 26
PspGI CCWGG 1 cut(s) 213
PspN4I GGNNCC 2 cut(s) 13, 102
PspPI GGNCC 1 cut(s) 12
PspPPI RGGWCCY 1 cut(s) 12
PstI CTGCAG 1 cut(s) 187
PstNI CAGNNNCTG 1 cut(s) 182
PsuI RGATCY 2 cut(s) 100, 217
RsaI GTAC 1 cut(s) 125
RsaNI GTAC 1 cut(s) 124
RseI CAYNNNNRTG 1 cut(s) 66
SaqAI TTAA 3 cut(s) 92, 156, 322
SatI GCNGC 2 cut(s) 183, 186
Sau3AI GATC 5 cut(s) 22, 58, 78, 100, 217
Sau96I GGNCC 1 cut(s) 12
SchI GAGTC 2 cut(s) 174, 305
ScrFI CCNGG 1 cut(s) 215
SduI GDGCHC 1 cut(s) 251
SetI ASST 3 cut(s) 86, 181, 254
SfaNI GCATC 1 cut(s) 196
SfcI CTRYAG 1 cut(s) 183
SinI GGWCC 1 cut(s) 12
SmiMI CAYNNNNRTG 1 cut(s) 66
Sse9I AATT 2 cut(s) 113, 319
SspI AATATT 1 cut(s) 160
StyD4I CCNGG 1 cut(s) 213
StyI CCWWGG 1 cut(s) 104
TasI AATT 2 cut(s) 113, 319
Tru1I TTAA 3 cut(s) 92, 156, 322
Tru9I TTAA 3 cut(s) 92, 156, 322
TseI GCWGC 2 cut(s) 182, 185
TspGWI ACGGA 1 cut(s) 280
VpaK11BI GGWCC 1 cut(s) 12
XapI RAATTY 1 cut(s) 113
XceI RCATGY 1 cut(s) 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.