Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009556.1

Orthogroup ID

OG0004203

Physical Location & Seq

Genomic Coordinates Forward (+)

2715 .. 4275

Gene Structure 1561 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009556.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 405 bp

atgacggatgttggttctcctccggctagttctagtgccagaaatctcctaggtttgatacggcagggttttgtaaaagatatggaacttgggtccctttctgatcccacccaatccacattctctttagttgatgaggatcatacattcgcaaatgctgtcaggtttactttgaatcaggatccaaggacaaaattctgtgggtacagcattcctcatccatcagataaccgagttaatattagaatccagactacaggtgatccagcaaaagatgtattcaaagatgcatgccaggatctcatggtgatgtgccagcatgtgagcaacacttttaacaaggctgtggttgatttcaaattgagcgactctgtggagggcatggatattgaatcagatagttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00230 ko00240 ko01100 ko03020 ko04623 ko05169 map00230 map00240 map01100 map03020 map04623 map05169

Pfam Domains

Protein Families

RNA_pol_L_2

Protein Analysis

134

Amino Acids

14.72

Weight (kDa)

4.71

Isoelectric Point (pI)

38.0

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004203)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G29540 AT2G29540 AT2G29540
fragaria_vesca	FvH4_6g26980 FvH4_7g06540
malus_domestica	MD10G1078400.v1.1
prunus_persica	Prupe.2G047700_v2.0.a1 Prupe.2G047700_v2.0.a1 Prupe.3G125300_v2.0.a1 Prupe.3G125300_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0334971 RchiOBHm_Chr2g0128821
rosa_laevigata	RLG00000019027
rosa_multiflora	Rmu_sc0007061.1_g000007 Rmu_sc0009556.1_g000001
rosa_roxburghii	Rroxscaffold_2G00115240 Rroxscaffold_4G00316330
rosa_rugosa	Rorug01G0118200 Rorug02G0281300 Rorug02G0281400 Rorug02G0281500 Rorug02G0281600 Rorug02G0281600
rosa_samantha	Rh1AG141500 Rh1BG110000 Rh1CG133400 Rh1DG146100 Rh2AG334100 Rh2BG342100 Rh2CG321000 Rh2DG358800
rosa_wichuraiana	Rw1G011740 Rw2G027000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	6 cut(s)	98, 147, 176, 189, 257, 306
AcsI	RAATTY	1 cut(s)	194
AfaI	GTAC	1 cut(s)	206
AgsI	TTSAA	4 cut(s)	175, 283, 358, 392
AjnI	CCWGG	1 cut(s)	294
AlwI	GGATC	6 cut(s)	98, 147, 176, 189, 257, 306
ApoI	RAATTY	1 cut(s)	194
AspA2I	CCTAGG	1 cut(s)	49
AspS9I	GGNCC	1 cut(s)	93
AsuHPI	GGTGA	2 cut(s)	272, 319
AvaII	GGWCC	1 cut(s)	93
AvrII	CCTAGG	1 cut(s)	49
BamHI	GGATCC	1 cut(s)	181
BccI	CCATC	1 cut(s)	229
BceAI	ACGGC	1 cut(s)	77
BciT130I	CCWGG	1 cut(s)	296
BfaI	CTAG	3 cut(s)	27, 33, 50
BfmI	CTRYAG	1 cut(s)	255
BlnI	CCTAGG	1 cut(s)	49
Bme1390I	CCNGG	1 cut(s)	296
Bme18I	GGWCC	1 cut(s)	93
BmgT120I	GGNCC	1 cut(s)	93
BmiI	GGNNCC	3 cut(s)	94, 95, 183
BmrFI	CCNGG	1 cut(s)	296
BmsI	GCATC	1 cut(s)	277
BsaBI	GATNNNNATC	1 cut(s)	138
BsaJI	CCNNGG	2 cut(s)	49, 185
Bse8I	GATNNNNATC	1 cut(s)	138
BseBI	CCWGG	1 cut(s)	296
BseDI	CCNNGG	2 cut(s)	49, 185
BseGI	GGATG	2 cut(s)	13, 217
BseJI	GATNNNNATC	1 cut(s)	138
BseRI	GAGGAG	1 cut(s)	9
BsiSI	CCGG	1 cut(s)	23
BslFI	GGGAC	1 cut(s)	79
BsmFI	GGGAC	1 cut(s)	79
BsmI	GAATGC	1 cut(s)	210
Bsp143I	GATC	5 cut(s)	103, 139, 181, 262, 298
BspLI	GGNNCC	3 cut(s)	94, 95, 183
BspPI	GGATC	6 cut(s)	98, 147, 176, 189, 257, 306
BssECI	CCNNGG	2 cut(s)	49, 185
BssMI	GATC	5 cut(s)	103, 139, 181, 262, 298
BssT1I	CCWWGG	2 cut(s)	49, 185
Bst2UI	CCWGG	1 cut(s)	296
BstC8I	GCNNGC	2 cut(s)	292, 317
BstF5I	GGATG	2 cut(s)	13, 217
BstKTI	GATC	5 cut(s)	106, 142, 184, 265, 301
BstMBI	GATC	5 cut(s)	103, 139, 181, 262, 298
BstNI	CCWGG	1 cut(s)	296
BstNSI	RCATGY	2 cut(s)	294, 323
BstSCI	CCNGG	1 cut(s)	294
BstSFI	CTRYAG	1 cut(s)	255
BstX2I	RGATCY	2 cut(s)	181, 298
BstYI	RGATCY	2 cut(s)	181, 298
BtsCI	GGATG	2 cut(s)	13, 217
Cac8I	GCNNGC	2 cut(s)	292, 317
Cfr13I	GGNCC	1 cut(s)	93
Csp6I	GTAC	1 cut(s)	205
CviAII	CATG	4 cut(s)	291, 304, 320, 382
CviJI	RGCY	2 cut(s)	26, 344
CviKI_1	RGCY	2 cut(s)	26, 344
CviQI	GTAC	1 cut(s)	205
DpnI	GATC	5 cut(s)	105, 141, 183, 264, 300
DpnII	GATC	5 cut(s)	103, 139, 181, 262, 298
Eco130I	CCWWGG	2 cut(s)	49, 185
Eco47I	GGWCC	1 cut(s)	93
EcoO109I	RGGNCCY	1 cut(s)	93
EcoRII	CCWGG	1 cut(s)	294
EcoT14I	CCWWGG	2 cut(s)	49, 185
EcoT22I	ATGCAT	1 cut(s)	292
ErhI	CCWWGG	2 cut(s)	49, 185
FaeI	CATG	4 cut(s)	294, 307, 323, 385
FaiI	YATR	6 cut(s)	83, 144, 292, 305, 321, 383
FaqI	GGGAC	1 cut(s)	79
FatI	CATG	4 cut(s)	290, 303, 319, 381
FokI	GGATG	2 cut(s)	20, 204
FspBI	CTAG	3 cut(s)	27, 33, 50
HapII	CCGG	1 cut(s)	23
Hin1II	CATG	4 cut(s)	294, 307, 323, 385
HinfI	GANTC	4 cut(s)	175, 246, 368, 392
HpaII	CCGG	1 cut(s)	23
HphI	GGTGA	2 cut(s)	272, 319
Hpy166II	GTNNAC	1 cut(s)	168
Hpy188I	TCNGA	3 cut(s)	103, 226, 397
Hpy188III	TCNNGA	2 cut(s)	179, 250
Hpy8I	GTNNAC	1 cut(s)	168
HpyCH4V	TGCA	1 cut(s)	290
Hsp92II	CATG	4 cut(s)	294, 307, 323, 385
KflI	GGGWCCC	1 cut(s)	93
Kzo9I	GATC	5 cut(s)	103, 139, 181, 262, 298
LweI	GCATC	1 cut(s)	277
MaeI	CTAG	3 cut(s)	27, 33, 50
MalI	GATC	5 cut(s)	105, 141, 183, 264, 300
MboI	GATC	5 cut(s)	103, 139, 181, 262, 298
MflI	RGATCY	2 cut(s)	181, 298
MluCI	AATT	2 cut(s)	194, 359
MlyI	GAGTC	1 cut(s)	362
MnlI	CCTC	4 cut(s)	30, 130, 225, 370
Mph1103I	ATGCAT	1 cut(s)	292
MseI	TTAA	3 cut(s)	237, 336, 403
MslI	CAYNNNNRTG	1 cut(s)	308
MspI	CCGG	1 cut(s)	23
MspR9I	CCNGG	1 cut(s)	296
Mva1269I	GAATGC	1 cut(s)	210
MvaI	CCWGG	1 cut(s)	296
NdeII	GATC	5 cut(s)	103, 139, 181, 262, 298
NlaIII	CATG	4 cut(s)	294, 307, 323, 385
NlaIV	GGNNCC	3 cut(s)	94, 95, 183
NsiI	ATGCAT	1 cut(s)	292
NspI	RCATGY	2 cut(s)	294, 323
PaeI	GCATGC	1 cut(s)	294
PctI	GAATGC	1 cut(s)	210
PfeI	GAWTC	3 cut(s)	175, 246, 392
PleI	GAGTC	1 cut(s)	362
PpsI	GAGTC	1 cut(s)	362
PpuMI	RGGWCCY	1 cut(s)	93
Psp5II	RGGWCCY	1 cut(s)	93
Psp6I	CCWGG	1 cut(s)	294
PspGI	CCWGG	1 cut(s)	294
PspN4I	GGNNCC	3 cut(s)	94, 95, 183
PspPI	GGNCC	1 cut(s)	93
PspPPI	RGGWCCY	1 cut(s)	93
PsuI	RGATCY	2 cut(s)	181, 298
RsaI	GTAC	1 cut(s)	206
RsaNI	GTAC	1 cut(s)	205
RseI	CAYNNNNRTG	1 cut(s)	308
SaqAI	TTAA	3 cut(s)	237, 336, 403
Sau3AI	GATC	5 cut(s)	103, 139, 181, 262, 298
Sau96I	GGNCC	1 cut(s)	93
SchI	GAGTC	1 cut(s)	362
ScrFI	CCNGG	1 cut(s)	296
SetI	ASST	3 cut(s)	55, 167, 262
SfaNI	GCATC	1 cut(s)	277
SfcI	CTRYAG	1 cut(s)	255
SinI	GGWCC	1 cut(s)	93
SmiMI	CAYNNNNRTG	1 cut(s)	308
SphI	GCATGC	1 cut(s)	294
Sse9I	AATT	2 cut(s)	194, 359
SspI	AATATT	1 cut(s)	241
SspMI	CTAG	3 cut(s)	27, 33, 50
StyD4I	CCNGG	1 cut(s)	294
StyI	CCWWGG	2 cut(s)	49, 185
TasI	AATT	2 cut(s)	194, 359
TfiI	GAWTC	3 cut(s)	175, 246, 392
Tru1I	TTAA	3 cut(s)	237, 336, 403
Tru9I	TTAA	3 cut(s)	237, 336, 403
TspGWI	ACGGA	1 cut(s)	20
VpaK11BI	GGWCC	1 cut(s)	93
XapI	RAATTY	1 cut(s)	194
XceI	RCATGY	2 cut(s)	294, 323
XmaJI	CCTAGG	1 cut(s)	49
XspI	CTAG	3 cut(s)	27, 33, 50
Zsp2I	ATGCAT	1 cut(s)	292

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.