Rorug01G0118200

DNA-directed RNA polymerases I and III subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0004203
Physical Location & Seq
Forward (+)
20731099 .. 20731392
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0118200.1

Sequence Viewer

Length: 294 bp
ATGACTACTGCCAGGGGACCGATGGGGTACATTGCACCTGAAGTGTTCTCCAGGAACTTAGGAAATGTGTCCTATAGGTCAGATGTCTATAGCTATGGAATGGTACTGCTTGAGATTGTAGGAAGGAGAAAGAACATTGTTTCAACCACAGAGAACACCAATGAAGTTTACCACCCAGAATGGATCTATAGTCTTCTAGAAGAAAAAGATGACCTACCTATCAATGTTGGGAAAGAAAGAGATGCTAAAATTGCAACGAGACTTGCGATTGTAGGTCTCTGGTGCATTCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00230 ko00240 ko01100 ko03020 ko04623 ko05169 map00230 map00240 map01100 map03020 map04623 map05169
Pfam Domains
Protein Families
RNA_pol_L_2

Protein Analysis

97

Amino Acids

11.04

Weight (kDa)

5.77

Isoelectric Point (pI)

27.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 4 - 52 6.7e-06 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 191
AcuI CTGAAG 1 cut(s) 60
AfaI GTAC 2 cut(s) 29, 105
AgsI TTSAA 2 cut(s) 144, 290
AjnI CCWGG 2 cut(s) 11, 50
AluBI AGCT 1 cut(s) 93
AluI AGCT 1 cut(s) 93
Alw26I GTCTC 2 cut(s) 253, 281
AlwI GGATC 1 cut(s) 191
AspS9I GGNCC 1 cut(s) 17
AvaII GGWCC 1 cut(s) 17
BbsI GAAGAC 1 cut(s) 185
BccI CCATC 1 cut(s) 16
BciT130I CCWGG 2 cut(s) 13, 52
BcoDI GTCTC 2 cut(s) 253, 281
BfaI CTAG 1 cut(s) 197
BfmI CTRYAG 3 cut(s) 73, 88, 187
Bme1390I CCNGG 2 cut(s) 13, 52
Bme18I GGWCC 1 cut(s) 17
BmgT120I GGNCC 1 cut(s) 17
BmiI GGNNCC 1 cut(s) 18
BmrFI CCNGG 2 cut(s) 13, 52
BmsI GCATC 1 cut(s) 232
BpiI GAAGAC 1 cut(s) 185
BpmI CTGGAG 1 cut(s) 34
BpuEI CTTGAG 1 cut(s) 131
BsaI GGTCTC 1 cut(s) 281
BsaJI CCNNGG 1 cut(s) 12
Bse3DI GCAATG 1 cut(s) 30
BseBI CCWGG 2 cut(s) 13, 52
BseDI CCNNGG 1 cut(s) 12
BseMI GCAATG 1 cut(s) 30
BslFI GGGAC 1 cut(s) 30
BsmAI GTCTC 2 cut(s) 253, 281
BsmFI GGGAC 1 cut(s) 30
BsmI GAATGC 1 cut(s) 285
Bso31I GGTCTC 1 cut(s) 281
Bsp143I GATC 1 cut(s) 183
BspLI GGNNCC 1 cut(s) 18
BspPI GGATC 1 cut(s) 191
BspTNI GGTCTC 1 cut(s) 281
BsrDI GCAATG 1 cut(s) 30
BssECI CCNNGG 1 cut(s) 12
BssMI GATC 1 cut(s) 183
Bst2UI CCWGG 2 cut(s) 13, 52
BstDEI CTNAG 1 cut(s) 58
BstKTI GATC 1 cut(s) 186
BstMAI GTCTC 2 cut(s) 253, 281
BstMBI GATC 1 cut(s) 183
BstMWI GCNNNNNNNGC 1 cut(s) 251
BstNI CCWGG 2 cut(s) 13, 52
BstSCI CCNGG 2 cut(s) 11, 50
BstSFI CTRYAG 3 cut(s) 73, 88, 187
BstV2I GAAGAC 1 cut(s) 185
BstX2I RGATCY 1 cut(s) 183
BstYI RGATCY 1 cut(s) 183
Cfr13I GGNCC 1 cut(s) 17
Csp6I GTAC 2 cut(s) 28, 104
CviJI RGCY 1 cut(s) 93
CviKI_1 RGCY 1 cut(s) 93
CviQI GTAC 2 cut(s) 28, 104
DdeI CTNAG 1 cut(s) 58
DpnI GATC 1 cut(s) 185
DpnII GATC 1 cut(s) 183
Eco31I GGTCTC 1 cut(s) 281
Eco47I GGWCC 1 cut(s) 17
Eco57I CTGAAG 1 cut(s) 60
EcoRII CCWGG 2 cut(s) 11, 50
FaiI YATR 4 cut(s) 75, 90, 96, 189
FaqI GGGAC 1 cut(s) 30
FspBI CTAG 1 cut(s) 197
GsuI CTGGAG 1 cut(s) 34
Hpy166II GTNNAC 1 cut(s) 169
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 1 cut(s) 197
Hpy8I GTNNAC 1 cut(s) 169
HpyAV CCTTC 1 cut(s) 117
HpyCH4V TGCA 3 cut(s) 35, 254, 285
HpyF10VI GCNNNNNNNGC 1 cut(s) 251
HpyF3I CTNAG 1 cut(s) 58
Kzo9I GATC 1 cut(s) 183
LpnPI CCDG 6 cut(s) 25, 37, 51, 64, 189, 265
LweI GCATC 1 cut(s) 232
MaeI CTAG 1 cut(s) 197
MalI GATC 1 cut(s) 185
MboI GATC 1 cut(s) 183
MboII GAAGA 2 cut(s) 185, 212
MflI RGATCY 1 cut(s) 183
MluCI AATT 1 cut(s) 249
MspR9I CCNGG 2 cut(s) 13, 52
Mva1269I GAATGC 1 cut(s) 285
MvaI CCWGG 2 cut(s) 13, 52
MwoI GCNNNNNNNGC 1 cut(s) 251
NdeII GATC 1 cut(s) 183
NlaIV GGNNCC 1 cut(s) 18
PcsI WCGNNNNNNNCGW 1 cut(s) 263
PctI GAATGC 1 cut(s) 285
PfoI TCCNGGA 1 cut(s) 50
Psp6I CCWGG 2 cut(s) 11, 50
PspGI CCWGG 2 cut(s) 11, 50
PspN4I GGNNCC 1 cut(s) 18
PspPI GGNCC 1 cut(s) 17
PsuI RGATCY 1 cut(s) 183
RsaI GTAC 2 cut(s) 29, 105
RsaNI GTAC 2 cut(s) 28, 104
Sau3AI GATC 1 cut(s) 183
Sau96I GGNCC 1 cut(s) 17
ScrFI CCNGG 2 cut(s) 13, 52
SetI ASST 6 cut(s) 40, 80, 95, 216, 220, 277
SfaNI GCATC 1 cut(s) 232
SfcI CTRYAG 3 cut(s) 73, 88, 187
SinI GGWCC 1 cut(s) 17
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
Sse9I AATT 1 cut(s) 249
SspMI CTAG 1 cut(s) 197
StyD4I CCNGG 2 cut(s) 11, 50
TaqII GACCGA 1 cut(s) 34
TasI AATT 1 cut(s) 249
TspDTI ATGAA 1 cut(s) 177
VpaK11BI GGWCC 1 cut(s) 17
XbaI TCTAGA 1 cut(s) 196
XcmI CCANNNNNNNNNTGG 1 cut(s) 19
XspI CTAG 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.