Rroxscaffold_4G00316330

DNA-directed RNA polymerases I and III subunit

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
41154092 .. 41155952
1861 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00316330.1

Sequence Viewer

Length: 405 bp
ATGACTGATGTTGGTTCTTCTCCGGCTAGTTCTACTGCCAGAAATATCCTAGGTTTAGTATGGCAGGGTTTTGTAAAAGATATGGAACTTGGGTCCCTTTCTGATCCCACCCAATCCACATTCTCTTTAGTTGATGAGGATCATACATTCGCAAATGCTGTCAGGTTTACTTTGAATCAGGATCCAAGGACAAAATTCTGTGGGTACAGCATTCCTCATCCATCAGATAACCGAGTTAATATTAGAATCCAGACTACAGGTGATCCAGCAAAAGATGTATTCAAAGATGCATGCCAGGATCTCATGGTGATGTGCCAGCATGTGAGCAACACTTTTAACAAGGCTGTGGTTGATTTCAAATCGAGAAACTCTGTGGAGGGCATGGATATTGAATCAGATAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

134

Amino Acids

14.78

Weight (kDa)

4.83

Isoelectric Point (pI)

41.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RNA_pol_L_2 PF13656 39 - 110 5.9e-27 RNA polymerase Rpb3/Rpb11 dimerisation domain
RNA_pol_L PF01193 40 - 102 1.5e-09 RNA polymerase Rpb3/Rpb11 dimerisation domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 6 cut(s) 98, 147, 176, 189, 257, 306
AcsI RAATTY 1 cut(s) 194
AfaI GTAC 1 cut(s) 206
AgsI TTSAA 4 cut(s) 175, 283, 358, 392
AjnI CCWGG 1 cut(s) 294
AlwI GGATC 6 cut(s) 98, 147, 176, 189, 257, 306
ApoI RAATTY 1 cut(s) 194
AspA2I CCTAGG 1 cut(s) 49
AspS9I GGNCC 1 cut(s) 93
AsuHPI GGTGA 2 cut(s) 272, 319
AvaII GGWCC 1 cut(s) 93
AvrII CCTAGG 1 cut(s) 49
BamHI GGATCC 1 cut(s) 181
BccI CCATC 1 cut(s) 229
BciT130I CCWGG 1 cut(s) 296
BfaI CTAG 2 cut(s) 27, 50
BfmI CTRYAG 1 cut(s) 255
BlnI CCTAGG 1 cut(s) 49
Bme1390I CCNGG 1 cut(s) 296
Bme18I GGWCC 1 cut(s) 93
BmgT120I GGNCC 1 cut(s) 93
BmiI GGNNCC 3 cut(s) 94, 95, 183
BmrFI CCNGG 1 cut(s) 296
BmsI GCATC 1 cut(s) 277
BsaBI GATNNNNATC 1 cut(s) 138
BsaJI CCNNGG 2 cut(s) 49, 185
Bse8I GATNNNNATC 1 cut(s) 138
BseBI CCWGG 1 cut(s) 296
BseDI CCNNGG 2 cut(s) 49, 185
BseGI GGATG 1 cut(s) 217
BseJI GATNNNNATC 1 cut(s) 138
BsiSI CCGG 1 cut(s) 23
BslFI GGGAC 1 cut(s) 79
BsmFI GGGAC 1 cut(s) 79
BsmI GAATGC 1 cut(s) 210
Bsp143I GATC 5 cut(s) 103, 139, 181, 262, 298
BspLI GGNNCC 3 cut(s) 94, 95, 183
BspPI GGATC 6 cut(s) 98, 147, 176, 189, 257, 306
BssECI CCNNGG 2 cut(s) 49, 185
BssMI GATC 5 cut(s) 103, 139, 181, 262, 298
BssT1I CCWWGG 2 cut(s) 49, 185
Bst2UI CCWGG 1 cut(s) 296
BstC8I GCNNGC 2 cut(s) 292, 317
BstF5I GGATG 1 cut(s) 217
BstKTI GATC 5 cut(s) 106, 142, 184, 265, 301
BstMBI GATC 5 cut(s) 103, 139, 181, 262, 298
BstNI CCWGG 1 cut(s) 296
BstNSI RCATGY 2 cut(s) 294, 323
BstSCI CCNGG 1 cut(s) 294
BstSFI CTRYAG 1 cut(s) 255
BstX2I RGATCY 2 cut(s) 181, 298
BstYI RGATCY 2 cut(s) 181, 298
BtsCI GGATG 1 cut(s) 217
Cac8I GCNNGC 2 cut(s) 292, 317
Cfr13I GGNCC 1 cut(s) 93
Csp6I GTAC 1 cut(s) 205
CviAII CATG 4 cut(s) 291, 304, 320, 382
CviJI RGCY 2 cut(s) 26, 344
CviKI_1 RGCY 2 cut(s) 26, 344
CviQI GTAC 1 cut(s) 205
DpnI GATC 5 cut(s) 105, 141, 183, 264, 300
DpnII GATC 5 cut(s) 103, 139, 181, 262, 298
Eco130I CCWWGG 2 cut(s) 49, 185
Eco47I GGWCC 1 cut(s) 93
EcoO109I RGGNCCY 1 cut(s) 93
EcoRII CCWGG 1 cut(s) 294
EcoT14I CCWWGG 2 cut(s) 49, 185
EcoT22I ATGCAT 1 cut(s) 292
ErhI CCWWGG 2 cut(s) 49, 185
FaeI CATG 4 cut(s) 294, 307, 323, 385
FaiI YATR 7 cut(s) 61, 83, 144, 292, 305, 321, 383
FaqI GGGAC 1 cut(s) 79
FatI CATG 4 cut(s) 290, 303, 319, 381
FokI GGATG 1 cut(s) 204
FspBI CTAG 2 cut(s) 27, 50
HapII CCGG 1 cut(s) 23
Hin1II CATG 4 cut(s) 294, 307, 323, 385
HinfI GANTC 3 cut(s) 175, 246, 392
HpaII CCGG 1 cut(s) 23
HphI GGTGA 2 cut(s) 272, 319
Hpy166II GTNNAC 1 cut(s) 168
Hpy188I TCNGA 3 cut(s) 103, 226, 397
Hpy188III TCNNGA 3 cut(s) 179, 250, 363
Hpy8I GTNNAC 1 cut(s) 168
HpyCH4V TGCA 1 cut(s) 290
Hsp92II CATG 4 cut(s) 294, 307, 323, 385
KflI GGGWCCC 1 cut(s) 93
Kzo9I GATC 5 cut(s) 103, 139, 181, 262, 298
LweI GCATC 1 cut(s) 277
MaeI CTAG 2 cut(s) 27, 50
MalI GATC 5 cut(s) 105, 141, 183, 264, 300
MboI GATC 5 cut(s) 103, 139, 181, 262, 298
MboII GAAGA 1 cut(s) 9
MflI RGATCY 2 cut(s) 181, 298
MluCI AATT 1 cut(s) 194
MnlI CCTC 3 cut(s) 130, 225, 370
Mph1103I ATGCAT 1 cut(s) 292
MseI TTAA 3 cut(s) 237, 336, 403
MslI CAYNNNNRTG 1 cut(s) 308
MspI CCGG 1 cut(s) 23
MspR9I CCNGG 1 cut(s) 296
Mva1269I GAATGC 1 cut(s) 210
MvaI CCWGG 1 cut(s) 296
NdeII GATC 5 cut(s) 103, 139, 181, 262, 298
NlaIII CATG 4 cut(s) 294, 307, 323, 385
NlaIV GGNNCC 3 cut(s) 94, 95, 183
NsiI ATGCAT 1 cut(s) 292
NspI RCATGY 2 cut(s) 294, 323
PaeI GCATGC 1 cut(s) 294
PctI GAATGC 1 cut(s) 210
PfeI GAWTC 3 cut(s) 175, 246, 392
PpuMI RGGWCCY 1 cut(s) 93
Psp5II RGGWCCY 1 cut(s) 93
Psp6I CCWGG 1 cut(s) 294
PspGI CCWGG 1 cut(s) 294
PspN4I GGNNCC 3 cut(s) 94, 95, 183
PspPI GGNCC 1 cut(s) 93
PspPPI RGGWCCY 1 cut(s) 93
PsuI RGATCY 2 cut(s) 181, 298
RsaI GTAC 1 cut(s) 206
RsaNI GTAC 1 cut(s) 205
RseI CAYNNNNRTG 1 cut(s) 308
SaqAI TTAA 3 cut(s) 237, 336, 403
Sau3AI GATC 5 cut(s) 103, 139, 181, 262, 298
Sau96I GGNCC 1 cut(s) 93
ScrFI CCNGG 1 cut(s) 296
SetI ASST 3 cut(s) 55, 167, 262
SfaNI GCATC 1 cut(s) 277
SfcI CTRYAG 1 cut(s) 255
SinI GGWCC 1 cut(s) 93
SmiMI CAYNNNNRTG 1 cut(s) 308
SphI GCATGC 1 cut(s) 294
Sse9I AATT 1 cut(s) 194
SspI AATATT 1 cut(s) 241
SspMI CTAG 2 cut(s) 27, 50
StyD4I CCNGG 1 cut(s) 294
StyI CCWWGG 2 cut(s) 49, 185
TaqI TCGA 1 cut(s) 362
TasI AATT 1 cut(s) 194
TfiI GAWTC 3 cut(s) 175, 246, 392
Tru1I TTAA 3 cut(s) 237, 336, 403
Tru9I TTAA 3 cut(s) 237, 336, 403
VpaK11BI GGWCC 1 cut(s) 93
XapI RAATTY 1 cut(s) 194
XceI RCATGY 2 cut(s) 294, 323
XmaJI CCTAGG 1 cut(s) 49
XspI CTAG 2 cut(s) 27, 50
Zsp2I ATGCAT 1 cut(s) 292
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.