Prupe.4G224700_v2.0.a1

NADH dehydrogenase ubiquinone 1 alpha subcomplex subunit

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
14135548 .. 14138147
2600 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G224700.3

Sequence Viewer

Length: 297 bp
ATGGCATGGAGAGGAAAGCTATCTCAGAACTTAAAGGAGCTTAGGGTTTTGCTCTGCCAATCTTCCCCTTCAAGCGCAACCACCAGAACATTTGTGGAGAAGAATTACAAGGATCTCAAGAGTTTGAACCCCAAATTGCCCATATTGATTCGTGAATGCAGAGGGATTGAGCCTCAGTTATGGGCTAGATATGACATGGGTGTTGAGAGGGGCGTTCGTTTGGAAGGTTTGACAGAGCCACAGATCTCGAAGGCACTCGAGGAACTTGTTAAAGTGGGGGAGTCTCTTAAAGCCTGA

Protein Analysis

99

Amino Acids

11.14

Weight (kDa)

9.47

Isoelectric Point (pI)

49.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 120
AgsI TTSAA 2 cut(s) 72, 127
AluBI AGCT 2 cut(s) 19, 40
AluI AGCT 2 cut(s) 19, 40
Alw26I GTCTC 1 cut(s) 288
AlwI GGATC 1 cut(s) 120
Ama87I CYCGRG 1 cut(s) 257
AspLEI GCGC 1 cut(s) 77
AvaI CYCGRG 1 cut(s) 257
BcoDI GTCTC 1 cut(s) 288
BfaI CTAG 1 cut(s) 186
BglII AGATCT 1 cut(s) 243
BmeT110I CYCGRG 1 cut(s) 257
Bpu10I CCTNAGC 1 cut(s) 41
BpuEI CTTGAG 1 cut(s) 101
BseMII CTCAG 2 cut(s) 38, 188
BsiHKCI CYCGRG 1 cut(s) 257
BsmAI GTCTC 1 cut(s) 288
BsmI GAATGC 1 cut(s) 161
BsoBI CYCGRG 1 cut(s) 257
Bsp143I GATC 2 cut(s) 112, 243
BspCNI CTCAG 2 cut(s) 37, 187
BspPI GGATC 1 cut(s) 120
BssMI GATC 2 cut(s) 112, 243
BstDEI CTNAG 3 cut(s) 24, 41, 174
BstHHI GCGC 1 cut(s) 77
BstKTI GATC 2 cut(s) 115, 246
BstMAI GTCTC 1 cut(s) 288
BstMBI GATC 2 cut(s) 112, 243
BstX2I RGATCY 2 cut(s) 112, 243
BstYI RGATCY 2 cut(s) 112, 243
CfoI GCGC 1 cut(s) 77
CviAII CATG 2 cut(s) 6, 196
CviJI RGCY 6 cut(s) 19, 40, 172, 185, 238, 293
CviKI_1 RGCY 6 cut(s) 19, 40, 172, 185, 238, 293
DdeI CTNAG 3 cut(s) 24, 41, 174
DpnI GATC 2 cut(s) 114, 245
DpnII GATC 2 cut(s) 112, 243
Eco88I CYCGRG 1 cut(s) 257
FaeI CATG 2 cut(s) 9, 199
FaiI YATR 5 cut(s) 7, 143, 181, 192, 197
FatI CATG 2 cut(s) 5, 195
FspBI CTAG 1 cut(s) 186
GlaI GCGC 1 cut(s) 76
HhaI GCGC 1 cut(s) 77
Hin1II CATG 2 cut(s) 9, 199
Hin6I GCGC 1 cut(s) 75
HinP1I GCGC 1 cut(s) 75
HinfI GANTC 2 cut(s) 148, 281
Hpy188I TCNGA 1 cut(s) 27
Hpy188III TCNNGA 3 cut(s) 118, 152, 247
HpyAV CCTTC 3 cut(s) 78, 218, 244
HpyCH4V TGCA 1 cut(s) 159
HpyF3I CTNAG 3 cut(s) 24, 41, 174
Hsp92II CATG 2 cut(s) 9, 199
HspAI GCGC 1 cut(s) 75
Kzo9I GATC 2 cut(s) 112, 243
LmnI GCTCC 1 cut(s) 37
LpnPI CCDG 1 cut(s) 97
MaeI CTAG 1 cut(s) 186
MalI GATC 2 cut(s) 114, 245
MboI GATC 2 cut(s) 112, 243
MboII GAAGA 2 cut(s) 54, 112
MflI RGATCY 2 cut(s) 112, 243
MluCI AATT 2 cut(s) 103, 134
MlyI GAGTC 1 cut(s) 290
MnlI CCTC 5 cut(s) 5, 155, 183, 201, 253
MseI TTAA 3 cut(s) 32, 270, 288
Mva1269I GAATGC 1 cut(s) 161
NdeII GATC 2 cut(s) 112, 243
NlaIII CATG 2 cut(s) 9, 199
PaeR7I CTCGAG 1 cut(s) 257
PctI GAATGC 1 cut(s) 161
PfeI GAWTC 1 cut(s) 148
PleI GAGTC 1 cut(s) 289
PpsI GAGTC 1 cut(s) 289
PspXI VCTCGAGB 1 cut(s) 257
PsuI RGATCY 2 cut(s) 112, 243
SaqAI TTAA 3 cut(s) 32, 270, 288
Sau3AI GATC 2 cut(s) 112, 243
SchI GAGTC 1 cut(s) 290
SetI ASST 3 cut(s) 21, 42, 229
Sfr274I CTCGAG 1 cut(s) 257
SlaI CTCGAG 1 cut(s) 257
SmlI CTYRAG 2 cut(s) 116, 257
SmoI CTYRAG 2 cut(s) 116, 257
Sse9I AATT 2 cut(s) 103, 134
SspMI CTAG 1 cut(s) 186
TaqI TCGA 2 cut(s) 248, 258
TasI AATT 2 cut(s) 103, 134
TfiI GAWTC 1 cut(s) 148
Tru1I TTAA 3 cut(s) 32, 270, 288
Tru9I TTAA 3 cut(s) 32, 270, 288
XcmI CCANNNNNNNNNTGG 1 cut(s) 91
XhoI CTCGAG 1 cut(s) 257
XspI CTAG 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.