Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004455.1

Orthogroup ID

OG0009186

Physical Location & Seq

Genomic Coordinates Forward (+)

46138 .. 46425

Gene Structure 288 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004455.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 288 bp

atgcaatctacagcgatcttctcaataggctggttcaagaaaatggcatggagaggaaatctatcggaactaagctccttaggatcctactctgctagttatctctttcaagcgtcaccacccagaacatttgtggagaagaattacaaggatctcaagagttttgaccccaaattgcccgtcttgattagcgagagcagtaggattgagcctcagctatgggctagatatgacttggataagatgattatttgggtagaggctatagcgaaacgtccatggctgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0003954 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0005740 GO:0005743 GO:0005746 GO:0005747 GO:0008137 GO:0008150 GO:0008152 GO:0016020 GO:0016491 GO:0016651 GO:0016655 GO:0019866 GO:0030964 GO:0031090 GO:0031966 GO:0031967 GO:0031975 GO:0032991 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044429 GO:0044444 GO:0044446 GO:0044455 GO:0044464 GO:0045271 GO:0050136 GO:0055114 GO:0070469 GO:0098796 GO:0098798 GO:0098800 GO:0098803 GO:1902494 GO:1990204

KEGG Pathways

Metabolic & Signaling

ko00190 ko01100 ko04714 ko04723 ko04932 ko05010 ko05012 ko05016 map00190 map01100 map04714 map04723 map04932 map05010 map05012 map05016

Pfam Domains

Protein Families

L51_S25_CI-B8

Protein Analysis

95

Amino Acids

11.06

Weight (kDa)

9.52

Isoelectric Point (pI)

58.66

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009186)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G47890
fragaria_vesca	FvH4_3g23621
malus_domestica	MD03G1192500.v1.1 MD11G1209000.v1.1
prunus_persica	Prupe.4G224700_v2.0.a1 Prupe.4G224700_v2.0.a1 Prupe.4G224700_v2.0.a1
pyrus_communis	pycom11g18390
rosa_chinensis	RchiOBHm_Chr5g0041661
rosa_laevigata	RLG00000033678
rosa_multiflora	Rmu_sc0000271.1_g000013 Rmu_sc0000706.1_g000019 Rmu_sc0000861.1_g000016 Rmu_sc0004455.1_g000011 Rmu_sc0011648.1_g000010
rosa_roxburghii	Rroxscaffold_1G00038840
rosa_rugosa	Rorug05G0194500
rosa_samantha	Rh5BG285300 Rh5CG317300 Rh5DG294100
rosa_wichuraiana	Rw0G011090 Rw5G026350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	3 cut(s)	78, 91, 159
AgsI	TTSAA	2 cut(s)	37, 110
AluBI	AGCT	2 cut(s)	75, 217
AluI	AGCT	2 cut(s)	75, 217
AlwI	GGATC	3 cut(s)	78, 91, 159
ArsI	GACNNNNNNTTYG	2 cut(s)	165, 197
AsuHPI	GGTGA	1 cut(s)	108
AxyI	CCTNAGG	1 cut(s)	79
BamHI	GGATCC	1 cut(s)	83
BbvCI	CCTCAGC	1 cut(s)	213
BfaI	CTAG	2 cut(s)	96, 225
BfmI	CTRYAG	3 cut(s)	9, 264, 284
BmiI	GGNNCC	1 cut(s)	85
Bpu10I	CCTNAGC	1 cut(s)	213
BpuEI	CTTGAG	1 cut(s)	140
BsaJI	CCNNGG	1 cut(s)	278
Bse21I	CCTNAGG	1 cut(s)	79
BseDI	CCNNGG	1 cut(s)	278
BseMII	CTCAG	1 cut(s)	227
Bsp143I	GATC	3 cut(s)	15, 83, 151
Bsp19I	CCATGG	1 cut(s)	278
BspCNI	CTCAG	1 cut(s)	226
BspLI	GGNNCC	1 cut(s)	85
BspPI	GGATC	3 cut(s)	78, 91, 159
BssECI	CCNNGG	1 cut(s)	278
BssMI	GATC	3 cut(s)	15, 83, 151
BssT1I	CCWWGG	1 cut(s)	278
BstDEI	CTNAG	3 cut(s)	71, 79, 213
BstDSI	CCRYGG	1 cut(s)	278
BstKTI	GATC	3 cut(s)	18, 86, 154
BstMBI	GATC	3 cut(s)	15, 83, 151
BstSFI	CTRYAG	3 cut(s)	9, 264, 284
BstX2I	RGATCY	2 cut(s)	83, 151
BstYI	RGATCY	2 cut(s)	83, 151
Bsu36I	CCTNAGG	1 cut(s)	79
BtgI	CCRYGG	1 cut(s)	278
CseI	GACGC	1 cut(s)	102
CviAII	CATG	2 cut(s)	48, 279
CviJI	RGCY	7 cut(s)	30, 75, 211, 217, 224, 263, 283
CviKI_1	RGCY	7 cut(s)	30, 75, 211, 217, 224, 263, 283
DdeI	CTNAG	3 cut(s)	71, 79, 213
DpnI	GATC	3 cut(s)	17, 85, 153
DpnII	GATC	3 cut(s)	15, 83, 151
Eco130I	CCWWGG	1 cut(s)	278
Eco81I	CCTNAGG	1 cut(s)	79
EcoT14I	CCWWGG	1 cut(s)	278
ErhI	CCWWGG	1 cut(s)	278
FaeI	CATG	2 cut(s)	51, 282
FaiI	YATR	5 cut(s)	49, 220, 231, 266, 280
FatI	CATG	2 cut(s)	47, 278
FspBI	CTAG	2 cut(s)	96, 225
HgaI	GACGC	1 cut(s)	102
Hin1II	CATG	2 cut(s)	51, 282
HphI	GGTGA	1 cut(s)	108
Hpy188I	TCNGA	1 cut(s)	67
Hpy188III	TCNNGA	3 cut(s)	37, 157, 184
HpyCH4IV	ACGT	1 cut(s)	274
HpyCH4V	TGCA	1 cut(s)	4
HpyF3I	CTNAG	3 cut(s)	71, 79, 213
HpySE526I	ACGT	1 cut(s)	274
Hsp92II	CATG	2 cut(s)	51, 282
Kzo9I	GATC	3 cut(s)	15, 83, 151
LmnI	GCTCC	1 cut(s)	80
LpnPI	CCDG	2 cut(s)	16, 136
MaeI	CTAG	2 cut(s)	96, 225
MaeII	ACGT	1 cut(s)	274
MaeIII	GTNAC	1 cut(s)	114
MalI	GATC	3 cut(s)	17, 85, 153
MboI	GATC	3 cut(s)	15, 83, 151
MboII	GAAGA	2 cut(s)	10, 151
MflI	RGATCY	2 cut(s)	83, 151
MluCI	AATT	2 cut(s)	142, 173
MnlI	CCTC	3 cut(s)	47, 222, 253
NcoI	CCATGG	1 cut(s)	278
NdeII	GATC	3 cut(s)	15, 83, 151
NlaIII	CATG	2 cut(s)	51, 282
NlaIV	GGNNCC	1 cut(s)	85
NmuCI	GTSAC	1 cut(s)	114
PspN4I	GGNNCC	1 cut(s)	85
PsuI	RGATCY	2 cut(s)	83, 151
Sau3AI	GATC	3 cut(s)	15, 83, 151
SetI	ASST	3 cut(s)	77, 219, 277
SfcI	CTRYAG	3 cut(s)	9, 264, 284
SmlI	CTYRAG	1 cut(s)	155
SmoI	CTYRAG	1 cut(s)	155
Sse9I	AATT	2 cut(s)	142, 173
SspMI	CTAG	2 cut(s)	96, 225
StyI	CCWWGG	1 cut(s)	278
TaiI	ACGT	1 cut(s)	277
TasI	AATT	2 cut(s)	142, 173
TseFI	GTSAC	1 cut(s)	114
Tsp45I	GTSAC	1 cut(s)	114
XcmI	CCANNNNNNNNNTGG	1 cut(s)	130
XspI	CTAG	2 cut(s)	96, 225

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.