pycom11g18390

mitochondrial respiratory chain complex I assembly

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Reverse (-)
20556972 .. 20557282
311 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g18390.1

Sequence Viewer

Length: 216 bp
ATGGCATGGAGAGGGAAGCTATCTCAGAACTTGAAGGAGCTTAGGGTTTTGCTTTGCCAATCGTCCCCTTCAAGCGCATCCACCAGAGCATTTGTGGAGAAGAATTACAAGGATCTGAAGAGTGCAAACCCCAAATTGCCCATCTTGATTCGTGAATGCAGAGGGATTGAGCCTCAGTTGTGGGCTAGATTTGGTATTCTTCCCCATCCTTCCTAA

Protein Analysis

72

Amino Acids

8.08

Weight (kDa)

10.14

Isoelectric Point (pI)

57.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
L51_S25_CI-B8 PF05047 28 - 65 3.7e-14 Mitochondrial ribosomal protein L51 / S25 / CI-B8 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 120
AcuI CTGAAG 1 cut(s) 137
AgsI TTSAA 2 cut(s) 34, 72
AluBI AGCT 2 cut(s) 19, 40
AluI AGCT 2 cut(s) 19, 40
AlwI GGATC 1 cut(s) 120
AspLEI GCGC 1 cut(s) 77
BccI CCATC 2 cut(s) 149, 213
BfaI CTAG 1 cut(s) 186
BmsI GCATC 1 cut(s) 86
Bpu10I CCTNAGC 1 cut(s) 41
BseGI GGATG 2 cut(s) 77, 205
BseMII CTCAG 2 cut(s) 38, 188
BslFI GGGAC 1 cut(s) 49
BsmFI GGGAC 1 cut(s) 49
BsmI GAATGC 1 cut(s) 161
Bsp143I GATC 1 cut(s) 112
BspCNI CTCAG 2 cut(s) 37, 187
BspPI GGATC 1 cut(s) 120
BssMI GATC 1 cut(s) 112
Bst6I CTCTTC 1 cut(s) 113
BstDEI CTNAG 3 cut(s) 24, 41, 174
BstF5I GGATG 2 cut(s) 77, 205
BstHHI GCGC 1 cut(s) 77
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BstX2I RGATCY 1 cut(s) 112
BstYI RGATCY 1 cut(s) 112
BtsCI GGATG 2 cut(s) 77, 205
CfoI GCGC 1 cut(s) 77
CviAII CATG 1 cut(s) 6
CviJI RGCY 4 cut(s) 19, 40, 172, 185
CviKI_1 RGCY 4 cut(s) 19, 40, 172, 185
DdeI CTNAG 3 cut(s) 24, 41, 174
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
Eam1104I CTCTTC 1 cut(s) 113
EarI CTCTTC 1 cut(s) 113
Eco57I CTGAAG 1 cut(s) 137
FaeI CATG 1 cut(s) 9
FaiI YATR 1 cut(s) 7
FaqI GGGAC 1 cut(s) 49
FatI CATG 1 cut(s) 5
FokI GGATG 2 cut(s) 64, 192
FspBI CTAG 1 cut(s) 186
GlaI GCGC 1 cut(s) 76
HhaI GCGC 1 cut(s) 77
Hin1II CATG 1 cut(s) 9
Hin6I GCGC 1 cut(s) 75
HinP1I GCGC 1 cut(s) 75
HinfI GANTC 1 cut(s) 148
Hpy188I TCNGA 2 cut(s) 27, 117
Hpy188III TCNNGA 2 cut(s) 145, 152
HpyAV CCTTC 2 cut(s) 28, 78
HpyCH4V TGCA 2 cut(s) 125, 159
HpyF3I CTNAG 3 cut(s) 24, 41, 174
Hsp92II CATG 1 cut(s) 9
HspAI GCGC 1 cut(s) 75
Kzo9I GATC 1 cut(s) 112
LmnI GCTCC 1 cut(s) 37
LpnPI CCDG 1 cut(s) 97
LweI GCATC 1 cut(s) 86
MaeI CTAG 1 cut(s) 186
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MboII GAAGA 3 cut(s) 112, 130, 191
MflI RGATCY 1 cut(s) 112
MluCI AATT 2 cut(s) 103, 134
MnlI CCTC 3 cut(s) 5, 155, 183
Mva1269I GAATGC 1 cut(s) 161
NdeII GATC 1 cut(s) 112
NlaIII CATG 1 cut(s) 9
PctI GAATGC 1 cut(s) 161
PfeI GAWTC 1 cut(s) 148
PsuI RGATCY 1 cut(s) 112
Sau3AI GATC 1 cut(s) 112
SetI ASST 2 cut(s) 21, 42
SfaNI GCATC 1 cut(s) 86
SgeI CNNG 8 cut(s) 18, 43, 84, 96, 121, 157, 164, 198
Sse9I AATT 2 cut(s) 103, 134
SspMI CTAG 1 cut(s) 186
TasI AATT 2 cut(s) 103, 134
TfiI GAWTC 1 cut(s) 148
XcmI CCANNNNNNNNNTGG 1 cut(s) 91
XspI CTAG 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.