Prupe.5G112400_v2.0.a1

phosphatidylinositol-3-phosphate binding

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
Physical Location & Seq
Forward (+)
11628277 .. 11629640
1364 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G112400.1

Sequence Viewer

Length: 405 bp
ATGCGAAGATCACCTGTTAGACCCTTTTGTTATGCTCTAGATTATCGTTGGTATGCTCTAGATTTAGCTGTTCTTGCGGTTGGAGTGATCGAAAGGACTATGACTGGTGAAAGAAAAAGTTTTCATCAAGTTGCATTTGACCATTTGAAAGATCTACAGAACCATTTGGAGGCTATCAATGACATCCCTCGCAAGATCATGATGGCGACGCTTTTACCTATGGATGATCTTTCTCTCAATTTGGCTCATTGTGCCTCGCCATGGAGCTATTCTGAATCACATTACACATGTGCTTCAGAGAAAACTGATATAACACGTGAAGAGGGAAACAAATCAGTTGTATCTTTCACGGGGAAACTACTAGATATATTACATCACTGTCTTCCTTCAACTGTAAGTTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

135

Amino Acids

15.27

Weight (kDa)

6.36

Isoelectric Point (pI)

51.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 403
AciI CCGC 1 cut(s) 77
AcuI CTGAAG 1 cut(s) 279
AcvI CACGTG 1 cut(s) 317
AfiI CCNNNNNNNGG 2 cut(s) 169, 261
AflIII ACRYGT 2 cut(s) 287, 314
AgsI TTSAA 2 cut(s) 148, 390
AluBI AGCT 2 cut(s) 68, 267
AluI AGCT 2 cut(s) 68, 267
AsuHPI GGTGA 2 cut(s) 3, 119
BbrPI CACGTG 1 cut(s) 317
BbsI GAAGAC 1 cut(s) 374
BccI CCATC 1 cut(s) 196
BfaI CTAG 3 cut(s) 38, 59, 362
BfmI CTRYAG 1 cut(s) 155
BglII AGATCT 1 cut(s) 151
BpiI GAAGAC 1 cut(s) 374
BsaAI YACGTR 1 cut(s) 317
BsaJI CCNNGG 1 cut(s) 260
Bsc4I CCNNNNNNNGG 2 cut(s) 169, 261
Bse1I ACTGG 1 cut(s) 109
BseDI CCNNGG 1 cut(s) 260
BseGI GGATG 2 cut(s) 183, 229
BseLI CCNNNNNNNGG 2 cut(s) 169, 261
BseNI ACTGG 1 cut(s) 109
BslI CCNNNNNNNGG 2 cut(s) 169, 261
Bsp143I GATC 5 cut(s) 8, 87, 151, 195, 226
Bsp19I CCATGG 1 cut(s) 260
BspACI CCGC 1 cut(s) 77
BspHI TCATGA 1 cut(s) 198
BsrI ACTGG 1 cut(s) 109
BssECI CCNNGG 1 cut(s) 260
BssMI GATC 5 cut(s) 8, 87, 151, 195, 226
BssT1I CCWWGG 1 cut(s) 260
Bst4CI ACNGT 2 cut(s) 380, 394
Bst6I CTCTTC 1 cut(s) 315
BstBAI YACGTR 1 cut(s) 317
BstDSI CCRYGG 1 cut(s) 260
BstF5I GGATG 2 cut(s) 183, 229
BstKTI GATC 5 cut(s) 11, 90, 154, 198, 229
BstMBI GATC 5 cut(s) 8, 87, 151, 195, 226
BstMWI GCNNNNNNNGC 2 cut(s) 74, 251
BstNSI RCATGY 1 cut(s) 291
BstSFI CTRYAG 1 cut(s) 155
BstV2I GAAGAC 1 cut(s) 374
BstX2I RGATCY 1 cut(s) 151
BstYI RGATCY 1 cut(s) 151
BtgI CCRYGG 1 cut(s) 260
BtsCI GGATG 2 cut(s) 183, 229
BtsIMutI CAGTG 1 cut(s) 376
CciI TCATGA 1 cut(s) 198
CseI GACGC 1 cut(s) 217
CviAII CATG 3 cut(s) 199, 261, 288
CviJI RGCY 4 cut(s) 68, 173, 245, 267
CviKI_1 RGCY 4 cut(s) 68, 173, 245, 267
DpnI GATC 5 cut(s) 10, 89, 153, 197, 228
DpnII GATC 5 cut(s) 8, 87, 151, 195, 226
Eam1104I CTCTTC 1 cut(s) 315
EarI CTCTTC 1 cut(s) 315
Eco130I CCWWGG 1 cut(s) 260
Eco57I CTGAAG 1 cut(s) 279
Eco72I CACGTG 1 cut(s) 317
EcoT14I CCWWGG 1 cut(s) 260
ErhI CCWWGG 1 cut(s) 260
FaeI CATG 3 cut(s) 202, 264, 291
FatI CATG 3 cut(s) 198, 260, 287
FokI GGATG 2 cut(s) 170, 236
FspBI CTAG 3 cut(s) 38, 59, 362
HgaI GACGC 1 cut(s) 217
Hin1II CATG 3 cut(s) 202, 264, 291
HinfI GANTC 1 cut(s) 275
HphI GGTGA 2 cut(s) 3, 119
Hpy188I TCNGA 2 cut(s) 274, 298
Hpy188III TCNNGA 3 cut(s) 38, 59, 199
Hpy99I CGWCG 1 cut(s) 211
HpyAV CCTTC 1 cut(s) 396
HpyCH4III ACNGT 2 cut(s) 380, 394
HpyCH4IV ACGT 1 cut(s) 316
HpyCH4V TGCA 1 cut(s) 134
HpyF10VI GCNNNNNNNGC 2 cut(s) 74, 251
HpySE526I ACGT 1 cut(s) 316
Hsp92II CATG 3 cut(s) 202, 264, 291
Kzo9I GATC 5 cut(s) 8, 87, 151, 195, 226
LmnI GCTCC 1 cut(s) 264
LpnPI CCDG 2 cut(s) 27, 90
MaeI CTAG 3 cut(s) 38, 59, 362
MaeII ACGT 1 cut(s) 316
MalI GATC 5 cut(s) 10, 89, 153, 197, 228
MboI GATC 5 cut(s) 8, 87, 151, 195, 226
MboII GAAGA 3 cut(s) 18, 332, 374
MflI RGATCY 1 cut(s) 151
MluCI AATT 1 cut(s) 238
MmeI TCCRAC 1 cut(s) 61
MnlI CCTC 4 cut(s) 163, 198, 265, 316
MwoI GCNNNNNNNGC 2 cut(s) 74, 251
NcoI CCATGG 1 cut(s) 260
NdeII GATC 5 cut(s) 8, 87, 151, 195, 226
NlaIII CATG 3 cut(s) 202, 264, 291
NspI RCATGY 1 cut(s) 291
PagI TCATGA 1 cut(s) 198
PciI ACATGT 1 cut(s) 287
PfeI GAWTC 1 cut(s) 275
PmaCI CACGTG 1 cut(s) 317
PmlI CACGTG 1 cut(s) 317
Ppu21I YACGTR 1 cut(s) 317
PscI ACATGT 1 cut(s) 287
PsiI TTATAA 1 cut(s) 403
PspCI CACGTG 1 cut(s) 317
PsuI RGATCY 1 cut(s) 151
Sau3AI GATC 5 cut(s) 8, 87, 151, 195, 226
SetI ASST 5 cut(s) 16, 70, 220, 269, 319
SfcI CTRYAG 1 cut(s) 155
Sse9I AATT 1 cut(s) 238
SsiI CCGC 1 cut(s) 77
SspMI CTAG 3 cut(s) 38, 59, 362
StyI CCWWGG 1 cut(s) 260
TaaI ACNGT 2 cut(s) 380, 394
TaiI ACGT 1 cut(s) 319
TaqI TCGA 1 cut(s) 90
TasI AATT 1 cut(s) 238
TfiI GAWTC 1 cut(s) 275
TscAI CASTG 1 cut(s) 383
TspDTI ATGAA 1 cut(s) 113
TspRI CASTG 1 cut(s) 383
XbaI TCTAGA 2 cut(s) 37, 58
XceI RCATGY 1 cut(s) 291
XspI CTAG 3 cut(s) 38, 59, 362
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.