Prupe.6G163500_v2.0.a1

DNA mismatch repair

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
15685374 .. 15685913
540 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G163500.1

Sequence Viewer

Length: 369 bp
ATGAACCCAAAACCCCAACTCAACAACCACCCAGACCGCAAAGGACCCACTAGTGTAGTGGTTTGGAGTATTTACTCCCTCAGGCAAAACAACCACCCACCACCCTCCTCCCCACCTCATCAGCCGCCAACCCCACCTCCCAAAATCACAGTCACTGTCAACTTCTCACCCTCCAAGCGCATTCTCCTCTCCTCCCACCTCACCTCCTCATCTTCCAAACCATCCAAACTACCCAAACTCTCTCCCCACACCCACAACCCTATACCCACTGCACCCAATCCCTCCCTCCACCAAAAGTTCTTCCAGAAGCTTCTAGAACCATCATCCGACATTCCAAAACCTTCTCCTTCTTCCAACCCACCTGCCTAG

Protein Analysis

123

Amino Acids

13.33

Weight (kDa)

10.62

Isoelectric Point (pI)

65.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014434)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G25540
fragaria_vesca FvH4_7g29360
malus_domestica MD07G1267600.v1.1
prunus_persica Prupe.2G293300_v2.0.a1 Prupe.6G163500_v2.0.a1
pyrus_communis pycom01g20970 pycom07g24520
rosa_chinensis RchiOBHm_Chr1g0377121
rosa_laevigata RLG00000026541
rosa_multiflora Rmu_ssc0000155.1_g000018
rosa_roxburghii Rroxscaffold_4G00281430
rosa_rugosa Rorug01G0401600
rosa_samantha Rh1AG419000 Rh1BG378100 Rh1CG392100 Rh1DG408800
rosa_wichuraiana Rw1G036750

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 37, 125
AhlI ACTAGT 1 cut(s) 50
AluBI AGCT 1 cut(s) 310
AluI AGCT 1 cut(s) 310
AlwNI CAGNNNCTG 1 cut(s) 155
ArsI GACNNNNNNTTYG 2 cut(s) 135, 167
AspLEI GCGC 1 cut(s) 180
AspS9I GGNCC 1 cut(s) 44
AsuHPI GGTGA 2 cut(s) 159, 193
AvaII GGWCC 1 cut(s) 44
AxyI CCTNAGG 1 cut(s) 80
BccI CCATC 2 cut(s) 229, 328
BcuI ACTAGT 1 cut(s) 50
BfaI CTAG 3 cut(s) 51, 314, 367
BisI GCNGC 1 cut(s) 125
BlsI GCNGC 1 cut(s) 126
Bme18I GGWCC 1 cut(s) 44
BmgT120I GGNCC 1 cut(s) 44
BmiI GGNNCC 1 cut(s) 46
BsaXI ACNNNNNCTCC 4 cut(s) 121, 151, 188, 218
Bse21I CCTNAGG 1 cut(s) 80
BseGI GGATG 2 cut(s) 221, 323
BseMII CTCAG 1 cut(s) 94
BseRI GAGGAG 4 cut(s) 97, 176, 181, 196
BsgI GTGCAG 1 cut(s) 255
BsmI GAATGC 1 cut(s) 180
BspACI CCGC 2 cut(s) 37, 125
BspCNI CTCAG 1 cut(s) 93
BspLI GGNNCC 1 cut(s) 46
Bst4CI ACNGT 2 cut(s) 151, 157
BstDEI CTNAG 1 cut(s) 80
BstF5I GGATG 2 cut(s) 221, 323
BstHHI GCGC 1 cut(s) 180
Bsu36I CCTNAGG 1 cut(s) 80
BtsCI GGATG 2 cut(s) 221, 323
BtsI GCAGTG 1 cut(s) 267
BtsIMutI CAGTG 2 cut(s) 153, 267
CaiI CAGNNNCTG 1 cut(s) 155
CfoI GCGC 1 cut(s) 180
Cfr13I GGNCC 1 cut(s) 44
CviJI RGCY 2 cut(s) 124, 310
CviKI_1 RGCY 2 cut(s) 124, 310
DdeI CTNAG 1 cut(s) 80
Eco47I GGWCC 1 cut(s) 44
Eco81I CCTNAGG 1 cut(s) 80
EcoO109I RGGNCCY 1 cut(s) 44
FaiI YATR 1 cut(s) 263
Fnu4HI GCNGC 1 cut(s) 125
FokI GGATG 2 cut(s) 208, 310
Fsp4HI GCNGC 1 cut(s) 125
FspBI CTAG 3 cut(s) 51, 314, 367
GlaI GCGC 1 cut(s) 179
GluI GCNGC 1 cut(s) 125
HhaI GCGC 1 cut(s) 180
Hin6I GCGC 1 cut(s) 178
HinP1I GCGC 1 cut(s) 178
HincII GTYRAC 1 cut(s) 160
HindII GTYRAC 1 cut(s) 160
HindIII AAGCTT 1 cut(s) 308
HphI GGTGA 2 cut(s) 159, 193
Hpy166II GTNNAC 1 cut(s) 160
Hpy188I TCNGA 1 cut(s) 328
Hpy188III TCNNGA 2 cut(s) 304, 314
Hpy8I GTNNAC 1 cut(s) 160
HpyAV CCTTC 2 cut(s) 351, 357
HpyCH4III ACNGT 2 cut(s) 151, 157
HpyCH4V TGCA 1 cut(s) 272
HpyF3I CTNAG 1 cut(s) 80
HspAI GCGC 1 cut(s) 178
LpnPI CCDG 3 cut(s) 45, 67, 317
MaeI CTAG 3 cut(s) 51, 314, 367
MaeIII GTNAC 1 cut(s) 151
MboII GAAGA 3 cut(s) 204, 292, 342
MmeI TCCRAC 1 cut(s) 351
Mva1269I GAATGC 1 cut(s) 180
NlaIV GGNNCC 1 cut(s) 46
NmuCI GTSAC 1 cut(s) 151
PctI GAATGC 1 cut(s) 180
PkrI GCNGC 1 cut(s) 126
PpuMI RGGWCCY 1 cut(s) 44
Psp5II RGGWCCY 1 cut(s) 44
PspN4I GGNNCC 1 cut(s) 46
PspPI GGNCC 1 cut(s) 44
PspPPI RGGWCCY 1 cut(s) 44
PstNI CAGNNNCTG 1 cut(s) 155
SatI GCNGC 1 cut(s) 125
Sau96I GGNCC 1 cut(s) 44
SetI ASST 7 cut(s) 118, 139, 201, 206, 312, 343, 364
SgeI CNNG 6 cut(s) 44, 63, 94, 187, 316, 326
SinI GGWCC 1 cut(s) 44
SpeI ACTAGT 1 cut(s) 50
SsiI CCGC 2 cut(s) 37, 125
SspMI CTAG 3 cut(s) 51, 314, 367
TaaI ACNGT 2 cut(s) 151, 157
TauI GCSGC 1 cut(s) 127
TscAI CASTG 2 cut(s) 160, 274
TseFI GTSAC 1 cut(s) 151
Tsp45I GTSAC 1 cut(s) 151
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 2 cut(s) 160, 274
VpaK11BI GGWCC 1 cut(s) 44
XbaI TCTAGA 1 cut(s) 313
XcmI CCANNNNNNNNNTGG 1 cut(s) 55
XspI CTAG 3 cut(s) 51, 314, 367
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.