Prupe.6G298100_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
27204338 .. 27204699
362 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G298100.1

Sequence Viewer

Length: 213 bp
ATGGTGAAAGGAGGGAGGTACATGCACAATTGGGTCGAAGTTGCACCGCCGATAATGATCTCCCATGAAAAATGTTCAAATTCTCCAAAATTGGAGACTATTGTTGAAGAGGGATCCGAGAGCTTTGAGATTCTGCCGAAACGAGTGGTGTTTCTCCTTCCAGTATTTCTTTCTTTTATTTCTTACCTTATATTGTATCGACAGATTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.08

Weight (kDa)

6.71

Isoelectric Point (pI)

65.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 47
AclWI GGATC 2 cut(s) 108, 121
AcsI RAATTY 1 cut(s) 79
AfaI GTAC 1 cut(s) 20
AgsI TTSAA 2 cut(s) 78, 107
AluBI AGCT 1 cut(s) 123
AluI AGCT 1 cut(s) 123
Alw26I GTCTC 1 cut(s) 89
AlwI GGATC 2 cut(s) 108, 121
ApoI RAATTY 1 cut(s) 79
AsuHPI GGTGA 1 cut(s) 16
BamHI GGATCC 1 cut(s) 113
BcoDI GTCTC 1 cut(s) 89
BmiI GGNNCC 1 cut(s) 115
BsaBI GATNNNNATC 1 cut(s) 56
Bse1I ACTGG 1 cut(s) 161
Bse8I GATNNNNATC 1 cut(s) 56
BseJI GATNNNNATC 1 cut(s) 56
BseNI ACTGG 1 cut(s) 161
BsmAI GTCTC 1 cut(s) 89
Bsp143I GATC 2 cut(s) 57, 113
BspACI CCGC 1 cut(s) 47
BspLI GGNNCC 1 cut(s) 115
BspPI GGATC 2 cut(s) 108, 121
BsrI ACTGG 1 cut(s) 161
BssMI GATC 2 cut(s) 57, 113
Bst6I CTCTTC 1 cut(s) 102
BstKTI GATC 2 cut(s) 60, 116
BstMAI GTCTC 1 cut(s) 89
BstMBI GATC 2 cut(s) 57, 113
BstNSI RCATGY 1 cut(s) 25
BstX2I RGATCY 1 cut(s) 113
BstYI RGATCY 1 cut(s) 113
Csp6I GTAC 1 cut(s) 19
CviAII CATG 2 cut(s) 22, 65
CviJI RGCY 1 cut(s) 123
CviKI_1 RGCY 1 cut(s) 123
CviQI GTAC 1 cut(s) 19
DpnI GATC 2 cut(s) 59, 115
DpnII GATC 2 cut(s) 57, 113
Eam1104I CTCTTC 1 cut(s) 102
EarI CTCTTC 1 cut(s) 102
FaeI CATG 2 cut(s) 25, 68
FaiI YATR 3 cut(s) 23, 66, 191
FatI CATG 2 cut(s) 21, 64
Hin1II CATG 2 cut(s) 25, 68
HinfI GANTC 1 cut(s) 130
HphI GGTGA 1 cut(s) 16
Hpy188I TCNGA 1 cut(s) 118
HpyAV CCTTC 1 cut(s) 167
HpyCH4V TGCA 2 cut(s) 25, 44
Hsp92II CATG 2 cut(s) 25, 68
Kzo9I GATC 2 cut(s) 57, 113
LpnPI CCDG 1 cut(s) 174
MalI GATC 2 cut(s) 59, 115
MboI GATC 2 cut(s) 57, 113
MboII GAAGA 1 cut(s) 119
MfeI CAATTG 1 cut(s) 28
MflI RGATCY 1 cut(s) 113
MluCI AATT 3 cut(s) 28, 79, 89
MnlI CCTC 3 cut(s) 5, 9, 103
MunI CAATTG 1 cut(s) 28
NdeII GATC 2 cut(s) 57, 113
NlaIII CATG 2 cut(s) 25, 68
NlaIV GGNNCC 1 cut(s) 115
NspI RCATGY 1 cut(s) 25
PfeI GAWTC 1 cut(s) 130
PspN4I GGNNCC 1 cut(s) 115
PsuI RGATCY 1 cut(s) 113
RsaI GTAC 1 cut(s) 20
RsaNI GTAC 1 cut(s) 19
Sau3AI GATC 2 cut(s) 57, 113
SetI ASST 3 cut(s) 20, 125, 189
SgeI CNNG 5 cut(s) 34, 77, 130, 155, 173
Sse9I AATT 3 cut(s) 28, 79, 89
SsiI CCGC 1 cut(s) 47
TaqI TCGA 2 cut(s) 36, 199
TasI AATT 3 cut(s) 28, 79, 89
TfiI GAWTC 1 cut(s) 130
TspDTI ATGAA 1 cut(s) 81
XapI RAATTY 1 cut(s) 79
XceI RCATGY 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.