Rh5CG123600

Endoplasmic reticulum oxidoreductin-1-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
10241195 .. 10251814
10620 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG123600.1

Sequence Viewer

Length: 228 bp
ATGGGTCTGATGGGAAGGGAAATGAGGATCATGCAGGACTTGGGCGAAGTTGCACCAGCACTTATGATTCCCCACGAGAAGCCTTCGAATAACATTTCGAAAATGGAGACCATCGCTGAAGATGAAGGGCTATTTTCTGATTATCATAGCTTTCAGATTGTGCCAAAGCGAGTGGTGTTTCTTCTTCCGAAAAGGCTTCCAATAATAAGAGATCGCCCAAAAGACTAA

Protein Analysis

75

Amino Acids

8.65

Weight (kDa)

6.73

Isoelectric Point (pI)

46.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 35
AcuI CTGAAG 1 cut(s) 138
AluBI AGCT 1 cut(s) 150
AluI AGCT 1 cut(s) 150
Alw26I GTCTC 1 cut(s) 101
AlwI GGATC 1 cut(s) 35
AsuII TTCGAA 2 cut(s) 86, 98
BauI CACGAG 1 cut(s) 74
BccI CCATC 2 cut(s) 4, 119
BcoDI GTCTC 1 cut(s) 101
Bpu14I TTCGAA 2 cut(s) 86, 98
BsaI GGTCTC 1 cut(s) 101
BsmAI GTCTC 1 cut(s) 101
Bso31I GGTCTC 1 cut(s) 101
Bsp119I TTCGAA 2 cut(s) 86, 98
Bsp143I GATC 2 cut(s) 27, 211
BspPI GGATC 1 cut(s) 35
BspT104I TTCGAA 2 cut(s) 86, 98
BspTNI GGTCTC 1 cut(s) 101
BssMI GATC 2 cut(s) 27, 211
BssSI CACGAG 1 cut(s) 74
Bst2BI CACGAG 1 cut(s) 74
BstBI TTCGAA 2 cut(s) 86, 98
BstKTI GATC 2 cut(s) 30, 214
BstMAI GTCTC 1 cut(s) 101
BstMBI GATC 2 cut(s) 27, 211
BtgZI GCGATG 1 cut(s) 97
CspCI CAANNNNNGTGG 2 cut(s) 153, 188
CviAII CATG 1 cut(s) 31
CviJI RGCY 4 cut(s) 82, 130, 150, 196
CviKI_1 RGCY 4 cut(s) 82, 130, 150, 196
DpnI GATC 2 cut(s) 29, 213
DpnII GATC 2 cut(s) 27, 211
Eco31I GGTCTC 1 cut(s) 101
Eco57I CTGAAG 1 cut(s) 138
FaeI CATG 1 cut(s) 34
FaiI YATR 3 cut(s) 32, 65, 147
FatI CATG 1 cut(s) 30
Hin1II CATG 1 cut(s) 34
HinfI GANTC 1 cut(s) 67
Hpy188I TCNGA 4 cut(s) 9, 139, 156, 189
HpyAV CCTTC 3 cut(s) 9, 93, 119
HpyCH4V TGCA 2 cut(s) 34, 53
Hsp92II CATG 1 cut(s) 34
Kzo9I GATC 2 cut(s) 27, 211
LpnPI CCDG 2 cut(s) 20, 69
MalI GATC 2 cut(s) 29, 213
MboI GATC 2 cut(s) 27, 211
MboII GAAGA 3 cut(s) 131, 173, 176
MnlI CCTC 1 cut(s) 18
NdeII GATC 2 cut(s) 27, 211
NlaIII CATG 1 cut(s) 34
NspV TTCGAA 2 cut(s) 86, 98
PfeI GAWTC 1 cut(s) 67
Sau3AI GATC 2 cut(s) 27, 211
SetI ASST 1 cut(s) 152
SfuI TTCGAA 2 cut(s) 86, 98
SgeI CNNG 7 cut(s) 43, 47, 52, 68, 86, 88, 182
TaqI TCGA 2 cut(s) 86, 98
TfiI GAWTC 1 cut(s) 67
TspDTI ATGAA 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.