Rh5BG111900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
10469985 .. 10470262
278 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG111900.1

Sequence Viewer

Length: 198 bp
ATGATGGTGAAAGAGATGAGCTACATCCACGACTTTGGTGAAGTTGCACCAACCATGCTCATCTCCCAATATCAGAGAACTTCGAAATGCCCGACGCTGGAGACCATCGACGAAGAAGGATCAACATCATCTCACAATATCAACTTTGAAATTCCAGCAACAAAGAGGAAAACTGTACATGAAGATAGCGACAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.39

Weight (kDa)

4.93

Isoelectric Point (pI)

58.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 127
AcsI RAATTY 1 cut(s) 150
AfaI GTAC 1 cut(s) 177
AfiI CCNNNNNNNGG 1 cut(s) 97
AgsI TTSAA 1 cut(s) 149
AluBI AGCT 2 cut(s) 21, 195
AluI AGCT 2 cut(s) 21, 195
Alw26I GTCTC 1 cut(s) 95
AlwI GGATC 1 cut(s) 127
ApoI RAATTY 1 cut(s) 150
AsuHPI GGTGA 2 cut(s) 19, 50
AsuII TTCGAA 1 cut(s) 83
BccI CCATC 1 cut(s) 113
BcoDI GTCTC 1 cut(s) 95
BfaI CTAG 1 cut(s) 196
BpmI CTGGAG 1 cut(s) 119
Bpu14I TTCGAA 1 cut(s) 83
BsaBI GATNNNNATC 1 cut(s) 124
BsaI GGTCTC 1 cut(s) 95
Bsc4I CCNNNNNNNGG 1 cut(s) 97
Bse8I GATNNNNATC 1 cut(s) 124
BseGI GGATG 1 cut(s) 24
BseJI GATNNNNATC 1 cut(s) 124
BseLI CCNNNNNNNGG 1 cut(s) 97
BslI CCNNNNNNNGG 1 cut(s) 97
BsmAI GTCTC 1 cut(s) 95
Bso31I GGTCTC 1 cut(s) 95
Bsp119I TTCGAA 1 cut(s) 83
Bsp1407I TGTACA 1 cut(s) 175
Bsp143I GATC 1 cut(s) 119
BspPI GGATC 1 cut(s) 127
BspT104I TTCGAA 1 cut(s) 83
BspTNI GGTCTC 1 cut(s) 95
BsrGI TGTACA 1 cut(s) 175
BssMI GATC 1 cut(s) 119
Bst4CI ACNGT 1 cut(s) 175
BstAUI TGTACA 1 cut(s) 175
BstBI TTCGAA 1 cut(s) 83
BstF5I GGATG 1 cut(s) 24
BstKTI GATC 1 cut(s) 122
BstMAI GTCTC 1 cut(s) 95
BstMBI GATC 1 cut(s) 119
BstXI CCANNNNNNTGG 1 cut(s) 35
BtsCI GGATG 1 cut(s) 24
CseI GACGC 1 cut(s) 103
Csp6I GTAC 1 cut(s) 176
CviAII CATG 2 cut(s) 55, 179
CviJI RGCY 2 cut(s) 21, 195
CviKI_1 RGCY 2 cut(s) 21, 195
CviQI GTAC 1 cut(s) 176
DpnI GATC 1 cut(s) 121
DpnII GATC 1 cut(s) 119
Eco31I GGTCTC 1 cut(s) 95
FaeI CATG 2 cut(s) 58, 182
FaiI YATR 2 cut(s) 56, 180
FatI CATG 2 cut(s) 54, 178
FokI GGATG 1 cut(s) 11
FspBI CTAG 1 cut(s) 196
GsuI CTGGAG 1 cut(s) 119
HgaI GACGC 1 cut(s) 103
Hin1II CATG 2 cut(s) 58, 182
HphI GGTGA 2 cut(s) 19, 50
Hpy188I TCNGA 1 cut(s) 75
Hpy99I CGWCG 2 cut(s) 97, 113
HpyAV CCTTC 1 cut(s) 110
HpyCH4III ACNGT 1 cut(s) 175
HpyCH4V TGCA 1 cut(s) 47
Hsp92II CATG 2 cut(s) 58, 182
Kzo9I GATC 1 cut(s) 119
LpnPI CCDG 2 cut(s) 83, 168
MaeI CTAG 1 cut(s) 196
MalI GATC 1 cut(s) 121
MboI GATC 1 cut(s) 119
MboII GAAGA 2 cut(s) 125, 194
MluCI AATT 1 cut(s) 150
MnlI CCTC 1 cut(s) 159
NdeII GATC 1 cut(s) 119
NlaIII CATG 2 cut(s) 58, 182
NspV TTCGAA 1 cut(s) 83
PcsI WCGNNNNNNNCGW 1 cut(s) 89
RsaI GTAC 1 cut(s) 177
RsaNI GTAC 1 cut(s) 176
Sau3AI GATC 1 cut(s) 119
SetI ASST 2 cut(s) 23, 197
SfuI TTCGAA 1 cut(s) 83
SgeI CNNG 6 cut(s) 41, 67, 103, 110, 167, 191
Sse9I AATT 1 cut(s) 150
SspMI CTAG 1 cut(s) 196
TaaI ACNGT 1 cut(s) 175
TaqI TCGA 2 cut(s) 83, 108
TasI AATT 1 cut(s) 150
TatI WGTACW 1 cut(s) 175
TspDTI ATGAA 1 cut(s) 195
XapI RAATTY 1 cut(s) 150
XspI CTAG 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.