Rroxscaffold_1G00061870

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
83933454 .. 83934782
1329 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00061870.1

Sequence Viewer

Length: 216 bp
ATGATGGTGAAAGAGATGAGCTACATCCACGACTTTGGTGAAGTTGCACCAACCATGCTCATCTCCCAATATCAGAGAACTTCGAAATGCCCGACGCTGGAGACCATCGACGAAGAAGGATCAACGTCATCTCACAATATCAACTTCGAAATTCCAGCAACAAAGAGGGTCTTATGTAGAGAGAAAGATGGTGATACATTTTGGGAAGCCAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.16

Weight (kDa)

4.8

Isoelectric Point (pI)

45.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 127
AcsI RAATTY 1 cut(s) 150
AfiI CCNNNNNNNGG 1 cut(s) 97
AluBI AGCT 1 cut(s) 21
AluI AGCT 1 cut(s) 21
Alw26I GTCTC 1 cut(s) 95
AlwI GGATC 1 cut(s) 127
ApoI RAATTY 1 cut(s) 150
AsuHPI GGTGA 3 cut(s) 19, 50, 203
AsuII TTCGAA 2 cut(s) 83, 147
BccI CCATC 2 cut(s) 113, 182
BcoDI GTCTC 1 cut(s) 95
BpmI CTGGAG 1 cut(s) 119
Bpu14I TTCGAA 2 cut(s) 83, 147
BsaI GGTCTC 1 cut(s) 95
Bsc4I CCNNNNNNNGG 1 cut(s) 97
BseGI GGATG 1 cut(s) 24
BseLI CCNNNNNNNGG 1 cut(s) 97
BslI CCNNNNNNNGG 1 cut(s) 97
BsmAI GTCTC 1 cut(s) 95
Bso31I GGTCTC 1 cut(s) 95
Bsp119I TTCGAA 2 cut(s) 83, 147
Bsp143I GATC 1 cut(s) 119
BspPI GGATC 1 cut(s) 127
BspT104I TTCGAA 2 cut(s) 83, 147
BspTNI GGTCTC 1 cut(s) 95
BssMI GATC 1 cut(s) 119
BstBI TTCGAA 2 cut(s) 83, 147
BstF5I GGATG 1 cut(s) 24
BstKTI GATC 1 cut(s) 122
BstMAI GTCTC 1 cut(s) 95
BstMBI GATC 1 cut(s) 119
BstXI CCANNNNNNTGG 1 cut(s) 35
BtsCI GGATG 1 cut(s) 24
CseI GACGC 1 cut(s) 103
CviAII CATG 1 cut(s) 55
CviJI RGCY 2 cut(s) 21, 209
CviKI_1 RGCY 2 cut(s) 21, 209
DpnI GATC 1 cut(s) 121
DpnII GATC 1 cut(s) 119
Eco31I GGTCTC 1 cut(s) 95
FaeI CATG 1 cut(s) 58
FaiI YATR 2 cut(s) 56, 175
FalI AAGNNNNNCTT 2 cut(s) 155, 187
FatI CATG 1 cut(s) 54
FokI GGATG 1 cut(s) 11
GsuI CTGGAG 1 cut(s) 119
HgaI GACGC 1 cut(s) 103
Hin1II CATG 1 cut(s) 58
HphI GGTGA 3 cut(s) 19, 50, 203
Hpy188I TCNGA 1 cut(s) 75
Hpy99I CGWCG 2 cut(s) 97, 113
HpyAV CCTTC 1 cut(s) 110
HpyCH4IV ACGT 1 cut(s) 125
HpyCH4V TGCA 1 cut(s) 47
HpySE526I ACGT 1 cut(s) 125
Hsp92II CATG 1 cut(s) 58
Kzo9I GATC 1 cut(s) 119
LpnPI CCDG 2 cut(s) 83, 168
MaeII ACGT 1 cut(s) 125
MalI GATC 1 cut(s) 121
MboI GATC 1 cut(s) 119
MboII GAAGA 1 cut(s) 125
MfeI CAATTG 1 cut(s) 211
MluCI AATT 2 cut(s) 150, 211
MnlI CCTC 1 cut(s) 159
MunI CAATTG 1 cut(s) 211
NdeII GATC 1 cut(s) 119
NlaIII CATG 1 cut(s) 58
NspV TTCGAA 2 cut(s) 83, 147
PcsI WCGNNNNNNNCGW 1 cut(s) 89
Sau3AI GATC 1 cut(s) 119
SetI ASST 2 cut(s) 23, 128
SfuI TTCGAA 2 cut(s) 83, 147
SgeI CNNG 5 cut(s) 41, 67, 103, 110, 167
Sse9I AATT 2 cut(s) 150, 211
TaiI ACGT 1 cut(s) 128
TaqI TCGA 3 cut(s) 83, 108, 147
TasI AATT 2 cut(s) 150, 211
XapI RAATTY 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.