Rroxscaffold_1G00061880

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
83934957 .. 83935221
265 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00061880.1

Sequence Viewer

Length: 210 bp
ATGGTGAAGGAGTTCAAAGGCATGCAAAACTGGGGAGAGATTGCACCAACAGCCCTGGTAACAACTCACAAAAAAGCTTCTAGTTTGCCTACACTAGACACTATTATTGAAGAAGGATCAGAAGGCTTTGAAGTTTTGCCAAAGGGGGTCTTGATTTGGCATGACATGTACGTATGGTGCATGAGGAATGCACTACATGAAAGAGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.84

Weight (kDa)

5.83

Isoelectric Point (pI)

39.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 124
AfaI GTAC 1 cut(s) 170
AflIII ACRYGT 1 cut(s) 165
AgsI TTSAA 3 cut(s) 16, 110, 131
AjnI CCWGG 1 cut(s) 54
AluBI AGCT 2 cut(s) 77, 206
AluI AGCT 2 cut(s) 77, 206
AlwI GGATC 1 cut(s) 124
Asp700I GAANNNNTTC 1 cut(s) 11
AsuHPI GGTGA 1 cut(s) 16
BciT130I CCWGG 1 cut(s) 56
BfaI CTAG 2 cut(s) 81, 95
Bme1390I CCNGG 1 cut(s) 56
BmrFI CCNGG 1 cut(s) 56
BmrI ACTGGG 1 cut(s) 40
BmuI ACTGGG 1 cut(s) 40
BsaAI YACGTR 1 cut(s) 172
BsaJI CCNNGG 1 cut(s) 54
Bse1I ACTGG 1 cut(s) 35
BseBI CCWGG 1 cut(s) 56
BseDI CCNNGG 1 cut(s) 54
BseNI ACTGG 1 cut(s) 35
BsmI GAATGC 1 cut(s) 193
Bsp143I GATC 1 cut(s) 116
BspPI GGATC 1 cut(s) 124
BsrI ACTGG 1 cut(s) 35
BssECI CCNNGG 1 cut(s) 54
BssMI GATC 1 cut(s) 116
Bst2UI CCWGG 1 cut(s) 56
BstBAI YACGTR 1 cut(s) 172
BstC8I GCNNGC 1 cut(s) 23
BstKTI GATC 1 cut(s) 119
BstMBI GATC 1 cut(s) 116
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstNI CCWGG 1 cut(s) 56
BstNSI RCATGY 2 cut(s) 25, 169
BstSCI CCNGG 1 cut(s) 54
BstSNI TACGTA 1 cut(s) 172
Cac8I GCNNGC 1 cut(s) 23
Csp6I GTAC 1 cut(s) 169
CviAII CATG 5 cut(s) 22, 161, 166, 181, 197
CviJI RGCY 4 cut(s) 53, 77, 126, 206
CviKI_1 RGCY 4 cut(s) 53, 77, 126, 206
CviQI GTAC 1 cut(s) 169
DpnI GATC 1 cut(s) 118
DpnII GATC 1 cut(s) 116
Eco105I TACGTA 1 cut(s) 172
EcoRII CCWGG 1 cut(s) 54
FaeI CATG 5 cut(s) 25, 164, 169, 184, 200
FaiI YATR 6 cut(s) 23, 162, 167, 175, 182, 198
FalI AAGNNNNNCTT 2 cut(s) 134, 166
FatI CATG 5 cut(s) 21, 160, 165, 180, 196
FspBI CTAG 2 cut(s) 81, 95
Hin1II CATG 5 cut(s) 25, 164, 169, 184, 200
HindIII AAGCTT 1 cut(s) 75
HphI GGTGA 1 cut(s) 16
Hpy188I TCNGA 1 cut(s) 121
Hpy188III TCNNGA 1 cut(s) 151
HpyAV CCTTC 2 cut(s) 107, 116
HpyCH4IV ACGT 1 cut(s) 171
HpyCH4V TGCA 4 cut(s) 25, 44, 180, 191
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
HpySE526I ACGT 1 cut(s) 171
Hsp92II CATG 5 cut(s) 25, 164, 169, 184, 200
Kzo9I GATC 1 cut(s) 116
LpnPI CCDG 3 cut(s) 16, 41, 68
MaeI CTAG 2 cut(s) 81, 95
MaeII ACGT 1 cut(s) 171
MaeIII GTNAC 1 cut(s) 58
MalI GATC 1 cut(s) 118
MboI GATC 1 cut(s) 116
MboII GAAGA 1 cut(s) 122
MnlI CCTC 1 cut(s) 177
MroXI GAANNNNTTC 1 cut(s) 11
MspR9I CCNGG 1 cut(s) 56
Mva1269I GAATGC 1 cut(s) 193
MvaI CCWGG 1 cut(s) 56
MwoI GCNNNNNNNGC 1 cut(s) 50
NdeII GATC 1 cut(s) 116
NlaIII CATG 5 cut(s) 25, 164, 169, 184, 200
NspI RCATGY 2 cut(s) 25, 169
PaeI GCATGC 1 cut(s) 25
PciI ACATGT 1 cut(s) 165
PctI GAATGC 1 cut(s) 193
PdmI GAANNNNTTC 1 cut(s) 11
Ppu21I YACGTR 1 cut(s) 172
PscI ACATGT 1 cut(s) 165
Psp6I CCWGG 1 cut(s) 54
PspGI CCWGG 1 cut(s) 54
RsaI GTAC 1 cut(s) 170
RsaNI GTAC 1 cut(s) 169
Sau3AI GATC 1 cut(s) 116
ScrFI CCNGG 1 cut(s) 56
SetI ASST 3 cut(s) 79, 174, 208
SnaBI TACGTA 1 cut(s) 172
SphI GCATGC 1 cut(s) 25
SspMI CTAG 2 cut(s) 81, 95
StyD4I CCNGG 1 cut(s) 54
TaiI ACGT 1 cut(s) 174
XceI RCATGY 2 cut(s) 25, 169
XmnI GAANNNNTTC 1 cut(s) 11
XspI CTAG 2 cut(s) 81, 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.