Rh5AG115000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
10677299 .. 10678250
952 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG115000.1

Sequence Viewer

Length: 171 bp
ATGGTGAAGGAGTTCAAAGGCATGCAAAACTGGGGAGAGGTTGCACCAAGAGCCCTGGTAACAACTCACAAAAAAGCTTCTAGTTTGCCTACACTAGAAACTATTATTGAAGAAGGATCAGAAGGCTTTGAAGTTTTGCCAAAGGGGGTCTTGGAGTATTTGGCTGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.19

Weight (kDa)

5.06

Isoelectric Point (pI)

29.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 124
AgsI TTSAA 3 cut(s) 16, 110, 131
AjnI CCWGG 1 cut(s) 54
AluBI AGCT 1 cut(s) 77
AluI AGCT 1 cut(s) 77
AlwI GGATC 1 cut(s) 124
Asp700I GAANNNNTTC 1 cut(s) 11
AsuHPI GGTGA 1 cut(s) 16
BanII GRGCYC 1 cut(s) 55
BciT130I CCWGG 1 cut(s) 56
BfaI CTAG 2 cut(s) 81, 95
Bme1390I CCNGG 1 cut(s) 56
BmrFI CCNGG 1 cut(s) 56
BmrI ACTGGG 1 cut(s) 40
BmuI ACTGGG 1 cut(s) 40
BsaJI CCNNGG 1 cut(s) 54
Bse1I ACTGG 1 cut(s) 35
BseBI CCWGG 1 cut(s) 56
BseDI CCNNGG 1 cut(s) 54
BseNI ACTGG 1 cut(s) 35
Bsp1286I GDGCHC 1 cut(s) 55
Bsp143I GATC 1 cut(s) 116
BspPI GGATC 1 cut(s) 124
BsrI ACTGG 1 cut(s) 35
BssECI CCNNGG 1 cut(s) 54
BssMI GATC 1 cut(s) 116
Bst2UI CCWGG 1 cut(s) 56
BstC8I GCNNGC 1 cut(s) 23
BstKTI GATC 1 cut(s) 119
BstMBI GATC 1 cut(s) 116
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstNI CCWGG 1 cut(s) 56
BstNSI RCATGY 1 cut(s) 25
BstSCI CCNGG 1 cut(s) 54
Cac8I GCNNGC 1 cut(s) 23
CviAII CATG 1 cut(s) 22
CviJI RGCY 4 cut(s) 53, 77, 126, 164
CviKI_1 RGCY 4 cut(s) 53, 77, 126, 164
DpnI GATC 1 cut(s) 118
DpnII GATC 1 cut(s) 116
Eco24I GRGCYC 1 cut(s) 55
EcoRII CCWGG 1 cut(s) 54
EcoT38I GRGCYC 1 cut(s) 55
FaeI CATG 1 cut(s) 25
FaiI YATR 1 cut(s) 23
FalI AAGNNNNNCTT 2 cut(s) 134, 166
FatI CATG 1 cut(s) 21
FriOI GRGCYC 1 cut(s) 55
FspBI CTAG 2 cut(s) 81, 95
Hin1II CATG 1 cut(s) 25
HindIII AAGCTT 1 cut(s) 75
HphI GGTGA 1 cut(s) 16
Hpy188I TCNGA 1 cut(s) 121
HpyAV CCTTC 2 cut(s) 107, 116
HpyCH4V TGCA 2 cut(s) 25, 44
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
Hsp92II CATG 1 cut(s) 25
Kzo9I GATC 1 cut(s) 116
LpnPI CCDG 3 cut(s) 16, 41, 68
MaeI CTAG 2 cut(s) 81, 95
MaeIII GTNAC 1 cut(s) 58
MalI GATC 1 cut(s) 118
MboI GATC 1 cut(s) 116
MboII GAAGA 1 cut(s) 122
MhlI GDGCHC 1 cut(s) 55
MnlI CCTC 1 cut(s) 31
MroXI GAANNNNTTC 1 cut(s) 11
MspR9I CCNGG 1 cut(s) 56
MvaI CCWGG 1 cut(s) 56
MwoI GCNNNNNNNGC 1 cut(s) 50
NdeII GATC 1 cut(s) 116
NlaIII CATG 1 cut(s) 25
NspI RCATGY 1 cut(s) 25
PaeI GCATGC 1 cut(s) 25
PdmI GAANNNNTTC 1 cut(s) 11
Psp6I CCWGG 1 cut(s) 54
PspGI CCWGG 1 cut(s) 54
Sau3AI GATC 1 cut(s) 116
ScrFI CCNGG 1 cut(s) 56
SduI GDGCHC 1 cut(s) 55
SetI ASST 2 cut(s) 42, 79
SgeI CNNG 8 cut(s) 34, 43, 60, 67, 68, 93, 107, 163
SphI GCATGC 1 cut(s) 25
SspMI CTAG 2 cut(s) 81, 95
StyD4I CCNGG 1 cut(s) 54
XceI RCATGY 1 cut(s) 25
XmnI GAANNNNTTC 1 cut(s) 11
XspI CTAG 2 cut(s) 81, 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.