Prupe.6G353700_v2.0.a1

secretory carrier-associated membrane protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
30091164 .. 30099464
8301 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G353700.1

Sequence Viewer

Length: 174 bp
ATGAATCTATACGATTCTAACCCTTTCGCCGATGACGAGGTCAATCCATTTGCAAATCCTGGAAGTGTCCCCCCTGCAAACTCAAGGCTTTCACCTCTTCCTCGTGAACCCTATGATCGCAATGCAACAATTGATATTCCTCTTGATTGGATAAGGCTGCAAAGCAACAATTGA

Protein Analysis

58

Amino Acids

6.43

Weight (kDa)

4.19

Isoelectric Point (pI)

65.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 58
ApeKI GCWGC 1 cut(s) 157
AsuHPI GGTGA 1 cut(s) 84
BauI CACGAG 1 cut(s) 102
BbvI GCAGC 1 cut(s) 144
BciT130I CCWGG 1 cut(s) 60
BisI GCNGC 1 cut(s) 158
BlsI GCNGC 1 cut(s) 159
Bme1390I CCNGG 1 cut(s) 60
BmrFI CCNGG 1 cut(s) 60
BpuEI CTTGAG 1 cut(s) 67
Bse3DI GCAATG 1 cut(s) 127
BseBI CCWGG 1 cut(s) 60
BseMI GCAATG 1 cut(s) 127
BseXI GCAGC 1 cut(s) 144
BslFI GGGAC 1 cut(s) 53
BsmFI GGGAC 1 cut(s) 53
Bsp143I GATC 1 cut(s) 115
BsrDI GCAATG 1 cut(s) 127
BssMI GATC 1 cut(s) 115
BssSI CACGAG 1 cut(s) 102
Bst2BI CACGAG 1 cut(s) 102
Bst2UI CCWGG 1 cut(s) 60
Bst6I CTCTTC 1 cut(s) 102
BstKTI GATC 1 cut(s) 118
BstMBI GATC 1 cut(s) 115
BstNI CCWGG 1 cut(s) 60
BstSCI CCNGG 1 cut(s) 58
BstV1I GCAGC 1 cut(s) 144
CviJI RGCY 2 cut(s) 88, 157
CviKI_1 RGCY 2 cut(s) 88, 157
DpnI GATC 1 cut(s) 117
DpnII GATC 1 cut(s) 115
Eam1104I CTCTTC 1 cut(s) 102
EarI CTCTTC 1 cut(s) 102
EcoRII CCWGG 1 cut(s) 58
FaiI YATR 2 cut(s) 10, 114
FaqI GGGAC 1 cut(s) 53
Fnu4HI GCNGC 1 cut(s) 158
Fsp4HI GCNGC 1 cut(s) 158
GluI GCNGC 1 cut(s) 158
HinfI GANTC 2 cut(s) 4, 14
HphI GGTGA 1 cut(s) 84
Hpy166II GTNNAC 1 cut(s) 107
Hpy188III TCNNGA 2 cut(s) 104, 143
Hpy8I GTNNAC 1 cut(s) 107
HpyCH4V TGCA 4 cut(s) 53, 77, 125, 160
Kzo9I GATC 1 cut(s) 115
LpnPI CCDG 3 cut(s) 45, 72, 87
Lsp1109I GCAGC 1 cut(s) 144
MalI GATC 1 cut(s) 117
MboI GATC 1 cut(s) 115
MboII GAAGA 1 cut(s) 89
MfeI CAATTG 2 cut(s) 129, 169
MluCI AATT 2 cut(s) 129, 169
MnlI CCTC 4 cut(s) 31, 105, 111, 150
MspR9I CCNGG 1 cut(s) 60
MunI CAATTG 2 cut(s) 129, 169
MvaI CCWGG 1 cut(s) 60
NdeII GATC 1 cut(s) 115
PcsI WCGNNNNNNNCGW 1 cut(s) 33
PfeI GAWTC 2 cut(s) 4, 14
PflFI GACNNNGTC 1 cut(s) 38
PfoI TCCNGGA 1 cut(s) 58
PkrI GCNGC 1 cut(s) 159
Psp6I CCWGG 1 cut(s) 58
PspGI CCWGG 1 cut(s) 58
PsyI GACNNNGTC 1 cut(s) 38
SatI GCNGC 1 cut(s) 158
Sau3AI GATC 1 cut(s) 115
ScrFI CCNGG 1 cut(s) 60
SetI ASST 2 cut(s) 42, 97
SgeI CNNG 8 cut(s) 49, 71, 72, 86, 96, 114, 116, 155
SmlI CTYRAG 1 cut(s) 82
SmoI CTYRAG 1 cut(s) 82
Sse9I AATT 2 cut(s) 129, 169
StyD4I CCNGG 1 cut(s) 58
TasI AATT 2 cut(s) 129, 169
TfiI GAWTC 2 cut(s) 4, 14
TseI GCWGC 1 cut(s) 157
TspDTI ATGAA 1 cut(s) 17
Tth111I GACNNNGTC 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.