Prupe.8G160400_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
OG0005418
Physical Location & Seq
Reverse (-)
16904992 .. 16906002
1011 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G160400.1

Sequence Viewer

Length: 441 bp
ATGGAGTGGTTCTACCCTAAGAGGAGGAGGGGTCCAGAGTGGAAACAAGGGTGGACTTGCCAGACCTTGGCCTCCATCTCTGCACCACCTCTGCATTTGCTCACCATCTTTGCCATTGTCATTGGCTTGCTATGGCTTTCTCAATACACAGAGTACAAGGCCCAAATGCAACACACAGCCTTTAATTTCCAGCTCTTCCTAATGGTGTTGCCTGTTTTGTTGATTTTTGTGGTAGCTTCATGTTCTTCAGTCCCTTCTAGTGGATGGTTCAGCTTTTGGTCCCAACATCCACAGCGTGTGCCAGCTCACCCGGCCAGGGGCGGTGGTGGCTCAGGCTCACCGTGGGGTGTTGCCTTCTTGTTGGTGCTGATTTTGGTCTTGCTATCTTACCAATCATCCTTTCATTCCAAGTGGCTTGGACCTCTTGGGATGTCAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

147

Amino Acids

16.42

Weight (kDa)

9.62

Isoelectric Point (pI)

56.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 67
AciI CCGC 1 cut(s) 321
AcoI YGGCCR 1 cut(s) 312
AcuI CTGAAG 1 cut(s) 231
AdeI CACNNNGTG 1 cut(s) 296
AfaI GTAC 1 cut(s) 155
AfiI CCNNNNNNNGG 4 cut(s) 67, 260, 316, 317
AjnI CCWGG 1 cut(s) 314
AjuI GAANNNNNNNTTGG 2 cut(s) 384, 416
AluBI AGCT 4 cut(s) 193, 236, 273, 305
AluI AGCT 4 cut(s) 193, 236, 273, 305
AoxI GGCC 3 cut(s) 69, 159, 312
AspS9I GGNCC 4 cut(s) 32, 160, 279, 419
AsuC2I CCSGG 1 cut(s) 311
AsuHPI GGTGA 3 cut(s) 94, 299, 330
AvaII GGWCC 3 cut(s) 32, 279, 419
BccI CCATC 3 cut(s) 83, 113, 258
BciT130I CCWGG 1 cut(s) 316
BcnI CCSGG 1 cut(s) 311
BfaI CTAG 1 cut(s) 258
Bme1390I CCNGG 2 cut(s) 311, 316
Bme18I GGWCC 3 cut(s) 32, 279, 419
BmgT120I GGNCC 4 cut(s) 32, 160, 279, 419
BmiI GGNNCC 2 cut(s) 33, 281
BmrFI CCNGG 2 cut(s) 311, 316
Bpu10I CCTNAGC 1 cut(s) 331
BpuMI CCSGG 1 cut(s) 311
BsaJI CCNNGG 3 cut(s) 66, 315, 341
BsaXI ACNNNNNCTCC 2 cut(s) 16, 46
Bsc4I CCNNNNNNNGG 4 cut(s) 67, 260, 316, 317
BseBI CCWGG 1 cut(s) 316
BseDI CCNNGG 3 cut(s) 66, 315, 341
BseGI GGATG 4 cut(s) 269, 286, 395, 435
BseLI CCNNNNNNNGG 4 cut(s) 67, 260, 316, 317
BseMII CTCAG 1 cut(s) 345
BseRI GAGGAG 2 cut(s) 37, 40
BsgI GTGCAG 1 cut(s) 66
BshFI GGCC 3 cut(s) 71, 161, 314
BsiSI CCGG 1 cut(s) 311
BslFI GGGAC 2 cut(s) 236, 265
BslI CCNNNNNNNGG 4 cut(s) 67, 260, 316, 317
BsmFI GGGAC 2 cut(s) 236, 265
BsnI GGCC 3 cut(s) 71, 161, 314
BspACI CCGC 1 cut(s) 321
BspANI GGCC 3 cut(s) 71, 161, 314
BspCNI CTCAG 1 cut(s) 344
BspLI GGNNCC 2 cut(s) 33, 281
BspQI GCTCTTC 1 cut(s) 200
BssECI CCNNGG 3 cut(s) 66, 315, 341
BssT1I CCWWGG 1 cut(s) 66
Bst2UI CCWGG 1 cut(s) 316
Bst4CI ACNGT 1 cut(s) 342
Bst6I CTCTTC 1 cut(s) 200
BstC8I GCNNGC 2 cut(s) 128, 303
BstDEI CTNAG 2 cut(s) 18, 331
BstDSI CCRYGG 1 cut(s) 341
BstF5I GGATG 4 cut(s) 269, 286, 395, 435
BstMWI GCNNNNNNNGC 2 cut(s) 311, 327
BstNI CCWGG 1 cut(s) 316
BstSCI CCNGG 2 cut(s) 309, 314
BsuRI GGCC 3 cut(s) 71, 161, 314
BtgI CCRYGG 1 cut(s) 341
BtsCI GGATG 4 cut(s) 269, 286, 395, 435
Cac8I GCNNGC 2 cut(s) 128, 303
Cfr13I GGNCC 4 cut(s) 32, 160, 279, 419
Csp6I GTAC 1 cut(s) 154
CviAII CATG 1 cut(s) 240
CviQI GTAC 1 cut(s) 154
DdeI CTNAG 2 cut(s) 18, 331
DraIII CACNNNGTG 1 cut(s) 296
EaeI YGGCCR 1 cut(s) 312
Eam1104I CTCTTC 1 cut(s) 200
EarI CTCTTC 1 cut(s) 200
Eco130I CCWWGG 1 cut(s) 66
Eco47I GGWCC 3 cut(s) 32, 279, 419
Eco57I CTGAAG 1 cut(s) 231
EcoRII CCWGG 1 cut(s) 314
EcoT14I CCWWGG 1 cut(s) 66
ErhI CCWWGG 1 cut(s) 66
FaeI CATG 1 cut(s) 243
FaiI YATR 2 cut(s) 133, 241
FaqI GGGAC 2 cut(s) 236, 265
FatI CATG 1 cut(s) 239
FokI GGATG 3 cut(s) 273, 276, 382
FspBI CTAG 1 cut(s) 258
HaeIII GGCC 3 cut(s) 71, 161, 314
HapII CCGG 1 cut(s) 311
Hin1II CATG 1 cut(s) 243
HpaII CCGG 1 cut(s) 311
HphI GGTGA 3 cut(s) 94, 299, 330
Hpy166II GTNNAC 1 cut(s) 54
Hpy188I TCNGA 1 cut(s) 436
Hpy188III TCNNGA 1 cut(s) 35
Hpy8I GTNNAC 1 cut(s) 54
HpyAV CCTTC 2 cut(s) 264, 364
HpyCH4III ACNGT 1 cut(s) 342
HpyCH4V TGCA 3 cut(s) 83, 94, 169
HpyF10VI GCNNNNNNNGC 2 cut(s) 311, 327
HpyF3I CTNAG 2 cut(s) 18, 331
Hsp92II CATG 1 cut(s) 243
LguI GCTCTTC 1 cut(s) 200
LpnPI CCDG 9 cut(s) 48, 74, 203, 225, 301, 315, 318, 324, 328
MaeI CTAG 1 cut(s) 258
MboII GAAGA 2 cut(s) 187, 237
MluCI AATT 1 cut(s) 184
MnlI CCTC 6 cut(s) 15, 18, 21, 82, 99, 432
MseI TTAA 2 cut(s) 183, 439
MspI CCGG 1 cut(s) 311
MspR9I CCNGG 2 cut(s) 311, 316
MvaI CCWGG 1 cut(s) 316
MwoI GCNNNNNNNGC 2 cut(s) 311, 327
NciI CCSGG 1 cut(s) 311
NlaIII CATG 1 cut(s) 243
NlaIV GGNNCC 2 cut(s) 33, 281
PciSI GCTCTTC 1 cut(s) 200
PflMI CCANNNNNTGG 1 cut(s) 67
Psp6I CCWGG 1 cut(s) 314
PspGI CCWGG 1 cut(s) 314
PspN4I GGNNCC 2 cut(s) 33, 281
PspPI GGNCC 4 cut(s) 32, 160, 279, 419
RsaI GTAC 1 cut(s) 155
RsaNI GTAC 1 cut(s) 154
SapI GCTCTTC 1 cut(s) 200
SaqAI TTAA 2 cut(s) 183, 439
Sau96I GGNCC 4 cut(s) 32, 160, 279, 419
ScrFI CCNGG 2 cut(s) 311, 316
SetI ASST 7 cut(s) 68, 91, 195, 238, 275, 307, 424
SinI GGWCC 3 cut(s) 32, 279, 419
Sse9I AATT 1 cut(s) 184
SsiI CCGC 1 cut(s) 321
SspMI CTAG 1 cut(s) 258
StyD4I CCNGG 2 cut(s) 309, 314
StyI CCWWGG 1 cut(s) 66
TaaI ACNGT 1 cut(s) 342
TasI AATT 1 cut(s) 184
TatI WGTACW 1 cut(s) 153
Tru1I TTAA 2 cut(s) 183, 439
Tru9I TTAA 2 cut(s) 183, 439
TspDTI ATGAA 2 cut(s) 228, 392
Van91I CCANNNNNTGG 1 cut(s) 67
VpaK11BI GGWCC 3 cut(s) 32, 279, 419
XspI CTAG 1 cut(s) 258
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.