pycom02g01480

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
Physical Location & Seq
Reverse (-)
892453 .. 892751
299 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g01480.1

Sequence Viewer

Length: 198 bp
ATGTGTTGTAATTGTAAACACCCCTTATCTCCAGACTCTTCTTGGGACCGCCCAAAGGGTAACCCGCCAATTCAGATGATTCAGAAAACCGTTAGAAGCAACGACCTTGTTTCCCTTCCACAAAAATGCAAAACCTTAAACCAGCTCAAGCAAATCCATGCCTATATCCTTACATGCCGTCTACCTGAAAACCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.45

Weight (kDa)

9.2

Isoelectric Point (pI)

46.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014629)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 181
AciI CCGC 2 cut(s) 49, 65
AfiI CCNNNNNNNGG 1 cut(s) 55
AluBI AGCT 1 cut(s) 145
AluI AGCT 1 cut(s) 145
AspS9I GGNCC 1 cut(s) 46
AvaII GGWCC 1 cut(s) 46
BceAI ACGGC 1 cut(s) 162
Bme18I GGWCC 1 cut(s) 46
BmgT120I GGNCC 1 cut(s) 46
BmiI GGNNCC 1 cut(s) 47
BpmI CTGGAG 1 cut(s) 15
BpuEI CTTGAG 1 cut(s) 131
Bsc4I CCNNNNNNNGG 1 cut(s) 55
BseLI CCNNNNNNNGG 1 cut(s) 55
BslFI GGGAC 1 cut(s) 59
BslI CCNNNNNNNGG 1 cut(s) 55
BsmFI GGGAC 1 cut(s) 59
BspACI CCGC 2 cut(s) 49, 65
BspLI GGNNCC 1 cut(s) 47
Bst4CI ACNGT 1 cut(s) 91
Bst6I CTCTTC 1 cut(s) 43
BstEII GGTNACC 1 cut(s) 59
BstNSI RCATGY 1 cut(s) 177
BstPI GGTNACC 1 cut(s) 59
Cfr13I GGNCC 1 cut(s) 46
CviAII CATG 2 cut(s) 158, 174
CviJI RGCY 1 cut(s) 145
CviKI_1 RGCY 1 cut(s) 145
Eam1104I CTCTTC 1 cut(s) 43
EarI CTCTTC 1 cut(s) 43
Eco47I GGWCC 1 cut(s) 46
Eco91I GGTNACC 1 cut(s) 59
EcoO65I GGTNACC 1 cut(s) 59
FaeI CATG 2 cut(s) 161, 177
FaiI YATR 3 cut(s) 159, 165, 175
FaqI GGGAC 1 cut(s) 59
FatI CATG 2 cut(s) 157, 173
FauI CCCGC 1 cut(s) 72
FblI GTMKAC 1 cut(s) 181
GsuI CTGGAG 1 cut(s) 15
Hin1II CATG 2 cut(s) 161, 177
HinfI GANTC 2 cut(s) 35, 79
Hpy166II GTNNAC 2 cut(s) 17, 182
Hpy188I TCNGA 2 cut(s) 75, 84
Hpy188III TCNNGA 1 cut(s) 32
Hpy8I GTNNAC 2 cut(s) 17, 182
HpyAV CCTTC 1 cut(s) 125
HpyCH4III ACNGT 1 cut(s) 91
HpyCH4V TGCA 1 cut(s) 129
Hsp92II CATG 2 cut(s) 161, 177
LpnPI CCDG 2 cut(s) 45, 155
MaeIII GTNAC 1 cut(s) 59
MboII GAAGA 1 cut(s) 30
MluCI AATT 2 cut(s) 10, 69
MlyI GAGTC 1 cut(s) 29
MseI TTAA 1 cut(s) 137
MslI CAYNNNNRTG 1 cut(s) 124
NlaIII CATG 2 cut(s) 161, 177
NlaIV GGNNCC 1 cut(s) 47
NspI RCATGY 1 cut(s) 177
PfeI GAWTC 1 cut(s) 79
PleI GAGTC 1 cut(s) 29
PpsI GAGTC 1 cut(s) 29
PspEI GGTNACC 1 cut(s) 59
PspN4I GGNNCC 1 cut(s) 47
PspPI GGNCC 1 cut(s) 46
RseI CAYNNNNRTG 1 cut(s) 124
SaqAI TTAA 1 cut(s) 137
Sau96I GGNCC 1 cut(s) 46
SchI GAGTC 1 cut(s) 29
SetI ASST 5 cut(s) 108, 137, 147, 187, 195
SgeI CNNG 8 cut(s) 44, 54, 76, 119, 154, 160, 170, 186
SinI GGWCC 1 cut(s) 46
SmiMI CAYNNNNRTG 1 cut(s) 124
SmlI CTYRAG 1 cut(s) 146
SmoI CTYRAG 1 cut(s) 146
Sse9I AATT 2 cut(s) 10, 69
SsiI CCGC 2 cut(s) 49, 65
TaaI ACNGT 1 cut(s) 91
TasI AATT 2 cut(s) 10, 69
TfiI GAWTC 1 cut(s) 79
Tru1I TTAA 1 cut(s) 137
Tru9I TTAA 1 cut(s) 137
VpaK11BI GGWCC 1 cut(s) 46
XceI RCATGY 1 cut(s) 177
XcmI CCANNNNNNNNNTGG 1 cut(s) 39
XmiI GTMKAC 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.