pycom03g14400

Fimbrin-1-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
Physical Location & Seq
Forward (+)
15739376 .. 15739705
330 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g14400.1

Sequence Viewer

Length: 207 bp
ATGTCAAGTTATGTGGGTGTTCACATTATGGATCAATCGCTTCAAAGCCAGTTCACGCAGGTTGAGCTTCGCAGTCTAGAATCCAAATTTAATTCAGTGAAGAATCAGAATGGTAAAGTTTTGGCTGGAGATTTGCCACCTTTAATGATGAAATTAAAGGCATTTAGAGAAATGTATTCTGAGGAGGATCGATCAGAGGTATCTTAA

Protein Analysis

69

Amino Acids

7.77

Weight (kDa)

5.7

Isoelectric Point (pI)

72.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 49
AclWI GGATC 2 cut(s) 39, 195
AcsI RAATTY 1 cut(s) 86
AgsI TTSAA 1 cut(s) 44
AluBI AGCT 1 cut(s) 67
AluI AGCT 1 cut(s) 67
AlwI GGATC 2 cut(s) 39, 195
ApoI RAATTY 1 cut(s) 86
BfaI CTAG 1 cut(s) 77
BfuAI ACCTGC 1 cut(s) 49
BpmI CTGGAG 1 cut(s) 147
Bsa29I ATCGAT 1 cut(s) 190
Bse1I ACTGG 1 cut(s) 49
BseCI ATCGAT 1 cut(s) 190
BseMII CTCAG 1 cut(s) 171
BseNI ACTGG 1 cut(s) 49
BseRI GAGGAG 1 cut(s) 197
BshVI ATCGAT 1 cut(s) 190
Bsp143I GATC 3 cut(s) 31, 187, 191
BspCNI CTCAG 1 cut(s) 172
BspDI ATCGAT 1 cut(s) 190
BspMI ACCTGC 1 cut(s) 49
BspPI GGATC 2 cut(s) 39, 195
BsrI ACTGG 1 cut(s) 49
BssMI GATC 3 cut(s) 31, 187, 191
BstDEI CTNAG 1 cut(s) 180
BstKTI GATC 3 cut(s) 34, 190, 194
BstMBI GATC 3 cut(s) 31, 187, 191
BstMWI GCNNNNNNNGC 1 cut(s) 64
Bsu15I ATCGAT 1 cut(s) 190
BsuTUI ATCGAT 1 cut(s) 190
BtsIMutI CAGTG 1 cut(s) 102
BveI ACCTGC 1 cut(s) 49
ClaI ATCGAT 1 cut(s) 190
CspCI CAANNNNNGTGG 1 cut(s) 29
CviJI RGCY 3 cut(s) 48, 67, 125
CviKI_1 RGCY 3 cut(s) 48, 67, 125
DdeI CTNAG 1 cut(s) 180
DpnI GATC 3 cut(s) 33, 189, 193
DpnII GATC 3 cut(s) 31, 187, 191
FaiI YATR 2 cut(s) 12, 29
FspBI CTAG 1 cut(s) 77
GsuI CTGGAG 1 cut(s) 147
HinfI GANTC 2 cut(s) 80, 103
Hpy166II GTNNAC 2 cut(s) 22, 54
Hpy188I TCNGA 3 cut(s) 108, 181, 196
Hpy188III TCNNGA 1 cut(s) 77
Hpy8I GTNNAC 2 cut(s) 22, 54
HpyF10VI GCNNNNNNNGC 1 cut(s) 64
HpyF3I CTNAG 1 cut(s) 180
Kzo9I GATC 3 cut(s) 31, 187, 191
LpnPI CCDG 3 cut(s) 44, 62, 111
MaeI CTAG 1 cut(s) 77
MalI GATC 3 cut(s) 33, 189, 193
MboI GATC 3 cut(s) 31, 187, 191
MboII GAAGA 1 cut(s) 112
MluCI AATT 3 cut(s) 86, 91, 152
MnlI CCTC 3 cut(s) 175, 178, 190
MseI TTAA 4 cut(s) 90, 143, 155, 205
MwoI GCNNNNNNNGC 1 cut(s) 64
NdeII GATC 3 cut(s) 31, 187, 191
PfeI GAWTC 2 cut(s) 80, 103
SaqAI TTAA 4 cut(s) 90, 143, 155, 205
Sau3AI GATC 3 cut(s) 31, 187, 191
SetI ASST 4 cut(s) 63, 69, 142, 201
SgeI CNNG 6 cut(s) 18, 61, 67, 71, 89, 138
Sse9I AATT 3 cut(s) 86, 91, 152
SspMI CTAG 1 cut(s) 77
TaqI TCGA 1 cut(s) 190
TasI AATT 3 cut(s) 86, 91, 152
TfiI GAWTC 2 cut(s) 80, 103
Tru1I TTAA 4 cut(s) 90, 143, 155, 205
Tru9I TTAA 4 cut(s) 90, 143, 155, 205
TscAI CASTG 1 cut(s) 102
TspDTI ATGAA 1 cut(s) 164
TspRI CASTG 1 cut(s) 102
XapI RAATTY 1 cut(s) 86
XbaI TCTAGA 1 cut(s) 76
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.