pycom05g02760

CS domain

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Reverse (-)
3266346 .. 3266888
543 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g02760.1

Sequence Viewer

Length: 282 bp
ATGGACTTTGGGGGACTTGGAAACAATATGGACTTTGGAGGACTCGGAAACAATATGAACTTTGGGGGACTTGGAAACAATATGAACTTTGGGGACTTTGATTTGTCTAAGTTGAACATGGGTGGCGATGGCTCGAATGCTGACGCACTTGGCAAGTTTGATGCAGAGAATGATGATAGTGACACAGAGGATGAAACTGTTGACCAACCACCATCCGCTGCTGGAGAATCTGACGCCAAACCTCTTGCGAGTGCAGAGCATGACGCAAAGGCTTCCGCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

9.48

Weight (kDa)

4.05

Isoelectric Point (pI)

15.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013609)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 216, 276
AcyI GRCGYC 1 cut(s) 234
AgsI TTSAA 1 cut(s) 115
ApeKI GCWGC 1 cut(s) 218
BbvI GCAGC 1 cut(s) 205
BccI CCATC 2 cut(s) 122, 220
BisI GCNGC 1 cut(s) 219
BlsI GCNGC 1 cut(s) 220
BmsI GCATC 1 cut(s) 151
BpmI CTGGAG 1 cut(s) 243
BsaHI GRCGYC 1 cut(s) 234
BseGI GGATG 2 cut(s) 196, 212
BseXI GCAGC 1 cut(s) 205
BsgI GTGCAG 1 cut(s) 273
BslFI GGGAC 3 cut(s) 27, 81, 107
BsmFI GGGAC 3 cut(s) 27, 81, 107
BsmI GAATGC 1 cut(s) 142
BspACI CCGC 2 cut(s) 216, 276
BssNI GRCGYC 1 cut(s) 234
Bst4CI ACNGT 1 cut(s) 199
BstACI GRCGYC 1 cut(s) 234
BstDEI CTNAG 1 cut(s) 108
BstF5I GGATG 2 cut(s) 196, 212
BstV1I GCAGC 1 cut(s) 205
BtgZI GCGATG 1 cut(s) 141
BtsCI GGATG 2 cut(s) 196, 212
CseI GACGC 3 cut(s) 152, 242, 272
CviAII CATG 2 cut(s) 118, 260
CviJI RGCY 2 cut(s) 132, 272
CviKI_1 RGCY 2 cut(s) 132, 272
DdeI CTNAG 1 cut(s) 108
EciI GGCGGA 1 cut(s) 265
FaeI CATG 2 cut(s) 121, 263
FaiI YATR 5 cut(s) 29, 56, 83, 119, 261
FaqI GGGAC 3 cut(s) 27, 81, 107
FatI CATG 2 cut(s) 117, 259
Fnu4HI GCNGC 1 cut(s) 219
FokI GGATG 2 cut(s) 199, 203
Fsp4HI GCNGC 1 cut(s) 219
GluI GCNGC 1 cut(s) 219
GsuI CTGGAG 1 cut(s) 243
HgaI GACGC 3 cut(s) 152, 242, 272
Hin1I GRCGYC 1 cut(s) 234
Hin1II CATG 2 cut(s) 121, 263
HincII GTYRAC 1 cut(s) 202
HindII GTYRAC 1 cut(s) 202
HinfI GANTC 2 cut(s) 42, 227
Hpy166II GTNNAC 1 cut(s) 202
Hpy188I TCNGA 2 cut(s) 47, 232
Hpy8I GTNNAC 1 cut(s) 202
HpyCH4III ACNGT 1 cut(s) 199
HpyCH4V TGCA 2 cut(s) 164, 254
HpyF3I CTNAG 1 cut(s) 108
Hsp92I GRCGYC 1 cut(s) 234
Hsp92II CATG 2 cut(s) 121, 263
LpnPI CCDG 1 cut(s) 207
Lsp1109I GCAGC 1 cut(s) 205
LweI GCATC 1 cut(s) 151
MaeIII GTNAC 1 cut(s) 179
MlyI GAGTC 1 cut(s) 36
MnlI CCTC 3 cut(s) 32, 181, 252
MspA1I CMGCKG 1 cut(s) 218
Mva1269I GAATGC 1 cut(s) 142
NlaIII CATG 2 cut(s) 121, 263
NmuCI GTSAC 1 cut(s) 179
PctI GAATGC 1 cut(s) 142
PfeI GAWTC 1 cut(s) 227
PkrI GCNGC 1 cut(s) 220
PleI GAGTC 1 cut(s) 36
PpsI GAGTC 1 cut(s) 36
SatI GCNGC 1 cut(s) 219
SchI GAGTC 1 cut(s) 36
SetI ASST 1 cut(s) 244
SfaNI GCATC 1 cut(s) 151
SsiI CCGC 2 cut(s) 216, 276
TaaI ACNGT 1 cut(s) 199
TaqI TCGA 1 cut(s) 134
TfiI GAWTC 1 cut(s) 227
TseFI GTSAC 1 cut(s) 179
TseI GCWGC 1 cut(s) 218
Tsp45I GTSAC 1 cut(s) 179
TspDTI ATGAA 3 cut(s) 71, 98, 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.