Rh6DG185600

CS domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0013609
Physical Location & Seq
Forward (+)
33020428 .. 33022919
2492 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG185600.1

Sequence Viewer

Length: 429 bp
ATGAGCCGACATCCTATTGTCAAGTGGGCTCAGCGGCCTGATACGCTTTACATTACTATCGACTTGCCTGATGCCCAGGATGTAAAGGTCAAACTGGAGCCTGAAGGAAAGTTTCTATTCTCTGCTACCACTGGACCAGAAAAGACACCCTATGAAGTTGATCTCGATCTCTATGACAAAATTGATGTAAATGAGAGTAAGGCTAGTATTGGCTTGAGAAATATCCGTTACATAGTGAAAAAGGCTGAAAATAAATGGTGGAGCAGATTGATAAAACAAGAAGGAAAACCTCCTGTGTTCTTGAAAGTTGATTGGGATAAATGGGTAGATGAGGATGAGGAGGAAGGCCAAGGACTTGGAAATGACATGGACTTTGGTGACATGGATTTCTCTGTAAGTATCTATACCATGGTTTGTCAAATTGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00590 ko01100 map00590 map01100
Pfam Domains
Protein Families
CS

Protein Analysis

142

Amino Acids

16.46

Weight (kDa)

4.69

Isoelectric Point (pI)

25.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CS PF04969 7 - 81 9.5e-12 CS domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013609)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g12740 FvH4_2g12740
malus_domestica MD05G1037300.v1.1 MD10G1041200.v1.1
prunus_persica Prupe.8G045200_v2.0.a1 Prupe.8G045200_v2.0.a1
pyrus_communis pycom05g02760 pycom10g02830
rosa_chinensis RchiOBHm_Chr6g0273521
rosa_laevigata RLG00000013610
rosa_multiflora Rmu_sc0001419.1_g000004
rosa_roxburghii Rroxscaffold_7G00195260
rosa_rugosa Rorug06G0076000
rosa_samantha Rh6AG190700 Rh6CG193800 Rh6DG185600
rosa_wichuraiana Rw6G005270 Rw6G016690

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 34
AcuI CTGAAG 1 cut(s) 123
AgsI TTSAA 1 cut(s) 304
AjnI CCWGG 1 cut(s) 75
AoxI GGCC 2 cut(s) 35, 346
ArsI GACNNNNNNTTYG 2 cut(s) 356, 388
AspS9I GGNCC 1 cut(s) 134
AsuHPI GGTGA 1 cut(s) 389
AvaII GGWCC 1 cut(s) 134
BanII GRGCYC 1 cut(s) 31
BciT130I CCWGG 1 cut(s) 77
BfaI CTAG 1 cut(s) 204
BisI GCNGC 1 cut(s) 35
BlpI GCTNAGC 1 cut(s) 30
BlsI GCNGC 1 cut(s) 36
Bme1390I CCNGG 1 cut(s) 77
Bme18I GGWCC 1 cut(s) 134
BmgT120I GGNCC 1 cut(s) 134
BmiI GGNNCC 1 cut(s) 99
BmrFI CCNGG 1 cut(s) 77
BmsI GCATC 1 cut(s) 61
BpmI CTGGAG 1 cut(s) 116
Bpu1102I GCTNAGC 1 cut(s) 30
BpuEI CTTGAG 1 cut(s) 235
BsaBI GATNNNNATC 1 cut(s) 165
BsaJI CCNNGG 3 cut(s) 75, 349, 408
Bse1I ACTGG 2 cut(s) 99, 136
Bse8I GATNNNNATC 1 cut(s) 165
BseBI CCWGG 1 cut(s) 77
BseDI CCNNGG 3 cut(s) 75, 349, 408
BseGI GGATG 3 cut(s) 10, 85, 340
BseJI GATNNNNATC 1 cut(s) 165
BseMII CTCAG 1 cut(s) 44
BseNI ACTGG 2 cut(s) 99, 136
BseRI GAGGAG 1 cut(s) 353
BshFI GGCC 2 cut(s) 37, 348
BsnI GGCC 2 cut(s) 37, 348
Bsp1286I GDGCHC 1 cut(s) 31
Bsp143I GATC 2 cut(s) 160, 166
Bsp1720I GCTNAGC 1 cut(s) 30
Bsp19I CCATGG 1 cut(s) 408
BspACI CCGC 1 cut(s) 34
BspANI GGCC 2 cut(s) 37, 348
BspCNI CTCAG 1 cut(s) 43
BspLI GGNNCC 1 cut(s) 99
BsrI ACTGG 2 cut(s) 99, 136
BssECI CCNNGG 3 cut(s) 75, 349, 408
BssMI GATC 2 cut(s) 160, 166
BssT1I CCWWGG 2 cut(s) 349, 408
Bst2UI CCWGG 1 cut(s) 77
BstDEI CTNAG 1 cut(s) 30
BstDSI CCRYGG 1 cut(s) 408
BstF5I GGATG 3 cut(s) 10, 85, 340
BstKTI GATC 2 cut(s) 163, 169
BstMBI GATC 2 cut(s) 160, 166
BstMWI GCNNNNNNNGC 1 cut(s) 43
BstNI CCWGG 1 cut(s) 77
BstSCI CCNGG 1 cut(s) 75
BstXI CCANNNNNNTGG 1 cut(s) 356
BsuRI GGCC 2 cut(s) 37, 348
BtgI CCRYGG 1 cut(s) 408
BtsCI GGATG 3 cut(s) 10, 85, 340
BtsIMutI CAGTG 1 cut(s) 129
Cfr13I GGNCC 1 cut(s) 134
CviAII CATG 3 cut(s) 367, 382, 409
CviJI RGCY 8 cut(s) 6, 29, 37, 100, 203, 213, 245, 348
CviKI_1 RGCY 8 cut(s) 6, 29, 37, 100, 203, 213, 245, 348
DdeI CTNAG 1 cut(s) 30
DpnI GATC 2 cut(s) 162, 168
DpnII GATC 2 cut(s) 160, 166
Eco130I CCWWGG 2 cut(s) 349, 408
Eco24I GRGCYC 1 cut(s) 31
Eco47I GGWCC 1 cut(s) 134
Eco57I CTGAAG 1 cut(s) 123
EcoRII CCWGG 1 cut(s) 75
EcoT14I CCWWGG 2 cut(s) 349, 408
EcoT38I GRGCYC 1 cut(s) 31
ErhI CCWWGG 2 cut(s) 349, 408
FaeI CATG 3 cut(s) 370, 385, 412
FaiI YATR 8 cut(s) 153, 174, 233, 368, 383, 405, 410, 427
FatI CATG 3 cut(s) 366, 381, 408
Fnu4HI GCNGC 1 cut(s) 35
FokI GGATG 2 cut(s) 92, 347
FriOI GRGCYC 1 cut(s) 31
Fsp4HI GCNGC 1 cut(s) 35
FspBI CTAG 1 cut(s) 204
GluI GCNGC 1 cut(s) 35
GsuI CTGGAG 1 cut(s) 116
HaeIII GGCC 2 cut(s) 37, 348
Hin1II CATG 3 cut(s) 370, 385, 412
HphI GGTGA 1 cut(s) 389
Hpy188III TCNNGA 2 cut(s) 164, 301
HpyAV CCTTC 3 cut(s) 98, 275, 338
HpyF10VI GCNNNNNNNGC 1 cut(s) 43
HpyF3I CTNAG 1 cut(s) 30
Hsp92II CATG 3 cut(s) 370, 385, 412
Kzo9I GATC 2 cut(s) 160, 166
LmnI GCTCC 2 cut(s) 97, 261
LpnPI CCDG 9 cut(s) 51, 62, 80, 81, 89, 114, 117, 150, 306
LweI GCATC 1 cut(s) 61
MaeI CTAG 1 cut(s) 204
MaeIII GTNAC 2 cut(s) 227, 377
MalI GATC 2 cut(s) 162, 168
MboI GATC 2 cut(s) 160, 166
MhlI GDGCHC 1 cut(s) 31
MluCI AATT 2 cut(s) 180, 420
MnlI CCTC 4 cut(s) 300, 325, 331, 334
MspA1I CMGCKG 1 cut(s) 34
MspR9I CCNGG 1 cut(s) 77
MvaI CCWGG 1 cut(s) 77
MwoI GCNNNNNNNGC 1 cut(s) 43
NcoI CCATGG 1 cut(s) 408
NdeII GATC 2 cut(s) 160, 166
NlaIII CATG 3 cut(s) 370, 385, 412
NlaIV GGNNCC 1 cut(s) 99
NmuCI GTSAC 1 cut(s) 377
PkrI GCNGC 1 cut(s) 36
Psp6I CCWGG 1 cut(s) 75
PspGI CCWGG 1 cut(s) 75
PspN4I GGNNCC 1 cut(s) 99
PspPI GGNCC 1 cut(s) 134
SatI GCNGC 1 cut(s) 35
Sau3AI GATC 2 cut(s) 160, 166
Sau96I GGNCC 1 cut(s) 134
ScrFI CCNGG 1 cut(s) 77
SduI GDGCHC 1 cut(s) 31
SetI ASST 2 cut(s) 90, 292
SfaNI GCATC 1 cut(s) 61
SinI GGWCC 1 cut(s) 134
SmlI CTYRAG 1 cut(s) 214
SmoI CTYRAG 1 cut(s) 214
Sse9I AATT 2 cut(s) 180, 420
SsiI CCGC 1 cut(s) 34
SspMI CTAG 1 cut(s) 204
StyD4I CCNGG 1 cut(s) 75
StyI CCWWGG 2 cut(s) 349, 408
TaqI TCGA 2 cut(s) 60, 165
TasI AATT 2 cut(s) 180, 420
TauI GCSGC 1 cut(s) 37
TscAI CASTG 1 cut(s) 136
TseFI GTSAC 1 cut(s) 377
Tsp45I GTSAC 1 cut(s) 377
TspDTI ATGAA 1 cut(s) 168
TspGWI ACGGA 1 cut(s) 215
TspRI CASTG 1 cut(s) 136
VpaK11BI GGWCC 1 cut(s) 134
XspI CTAG 1 cut(s) 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.