pycom06g12940

Plays an essential role in chain termination during de novo fatty acid synthesis

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr6
Physical Location & Seq
Forward (+)
18006517 .. 18006738
222 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom06g12940.1

Sequence Viewer

Length: 222 bp
ATGACATTGGAGTATAGACGTGAATGTAGGCAATCAAATTTGCTAGAGTCCCTAACAAGTACAACATCAAGTTTGGCTGATGACTCCAACTTCAAGAACAACGCCATCAATCGTAGACCAGACCTAGAATACACACACCTTCTTCGGATGCAGGCCGATAAGGTGGAGATAATACGAGCACGAACGGAATGGAATAGGAAACAAAAGCATAAACTGCATTGA

Protein Analysis

74

Amino Acids

8.77

Weight (kDa)

9.65

Isoelectric Point (pI)

48.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013671)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 115
AcsI RAATTY 1 cut(s) 37
AfaI GTAC 1 cut(s) 61
AgsI TTSAA 1 cut(s) 94
AjiI CACGTC 1 cut(s) 20
Alw21I GWGCWC 1 cut(s) 181
AoxI GGCC 1 cut(s) 153
ApoI RAATTY 1 cut(s) 37
Bbv12I GWGCWC 1 cut(s) 181
BccI CCATC 1 cut(s) 113
BfaI CTAG 2 cut(s) 44, 125
BmgBI CACGTC 1 cut(s) 20
BmsI GCATC 1 cut(s) 138
BseGI GGATG 1 cut(s) 153
BshFI GGCC 1 cut(s) 155
BsiHKAI GWGCWC 1 cut(s) 181
BslFI GGGAC 1 cut(s) 34
BsmFI GGGAC 1 cut(s) 34
BsnI GGCC 1 cut(s) 155
Bsp1286I GDGCHC 1 cut(s) 181
BspANI GGCC 1 cut(s) 155
BstAPI GCANNNNNTGC 1 cut(s) 214
BstC8I GCNNGC 1 cut(s) 153
BstF5I GGATG 1 cut(s) 153
BstMWI GCNNNNNNNGC 1 cut(s) 214
BsuRI GGCC 1 cut(s) 155
BtrI CACGTC 1 cut(s) 20
BtsCI GGATG 1 cut(s) 153
Cac8I GCNNGC 1 cut(s) 153
Csp6I GTAC 1 cut(s) 60
CviJI RGCY 2 cut(s) 77, 155
CviKI_1 RGCY 2 cut(s) 77, 155
CviQI GTAC 1 cut(s) 60
FaiI YATR 2 cut(s) 15, 210
FaqI GGGAC 1 cut(s) 34
FblI GTMKAC 1 cut(s) 115
FokI GGATG 1 cut(s) 160
FspBI CTAG 2 cut(s) 44, 125
HaeIII GGCC 1 cut(s) 155
HinfI GANTC 2 cut(s) 47, 83
Hpy166II GTNNAC 1 cut(s) 116
Hpy188I TCNGA 1 cut(s) 147
Hpy188III TCNNGA 1 cut(s) 94
Hpy8I GTNNAC 1 cut(s) 116
HpyAV CCTTC 1 cut(s) 149
HpyCH4IV ACGT 1 cut(s) 19
HpyCH4V TGCA 2 cut(s) 151, 217
HpyF10VI GCNNNNNNNGC 1 cut(s) 214
HpySE526I ACGT 1 cut(s) 19
LpnPI CCDG 2 cut(s) 132, 137
LweI GCATC 1 cut(s) 138
MaeI CTAG 2 cut(s) 44, 125
MaeII ACGT 1 cut(s) 19
MboII GAAGA 1 cut(s) 134
MhlI GDGCHC 1 cut(s) 181
MluCI AATT 1 cut(s) 37
MlyI GAGTC 2 cut(s) 56, 77
MmeI TCCRAC 1 cut(s) 111
MwoI GCNNNNNNNGC 1 cut(s) 214
PleI GAGTC 2 cut(s) 55, 77
PpsI GAGTC 2 cut(s) 55, 77
RsaI GTAC 1 cut(s) 61
RsaNI GTAC 1 cut(s) 60
SchI GAGTC 2 cut(s) 56, 77
SduI GDGCHC 1 cut(s) 181
SetI ASST 4 cut(s) 22, 126, 141, 165
SfaNI GCATC 1 cut(s) 138
Sse9I AATT 1 cut(s) 37
SspMI CTAG 2 cut(s) 44, 125
TaiI ACGT 1 cut(s) 22
TasI AATT 1 cut(s) 37
TatI WGTACW 1 cut(s) 59
TspGWI ACGGA 1 cut(s) 200
XapI RAATTY 1 cut(s) 37
XmiI GTMKAC 1 cut(s) 115
XspI CTAG 2 cut(s) 44, 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.