pycom07g24480

methyl-CpG-binding domain-containing protein 13

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
OG0003930
Physical Location & Seq
Forward (+)
25180332 .. 25181789
1458 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g24480.1

Sequence Viewer

Length: 327 bp
ATGGAGGAGCAGAACTCCGAGGACTGGCTCCCAACTGGATGGACAGTGGAGGTCAAGTTTAGAAAAAATGGCAGAAGAGACAAGTATTATTACGAATCCTCAAGTGGGCATAGATTTAGTTCCAGGGCAGAGGTATCTCGATATCTCAGCACCTCCAGTCATGAAGACGAACAGAAAATTAAAGAGACTCTCAAGCGACCTTCAGATGATATTGTAGTTGAGAAGACTGTAGCAGAAGGACTACCTCCAGGATGGACCAAAGAAATTCGGATTACAAAAAAGGCTCGTAAGACTAGGAGAGACACGGGATGTGCATCGGTATCTTGA

Protein Analysis

109

Amino Acids

12.54

Weight (kDa)

9.27

Isoelectric Point (pI)

51.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MBD PF01429 5 - 59 7.2e-09 Methyl-CpG binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 264
AcuI CTGAAG 1 cut(s) 186
AfiI CCNNNNNNNGG 2 cut(s) 24, 105
AjnI CCWGG 2 cut(s) 122, 247
Alw26I GTCTC 3 cut(s) 72, 179, 294
ApoI RAATTY 1 cut(s) 264
AspS9I GGNCC 1 cut(s) 255
AvaII GGWCC 1 cut(s) 255
BbsI GAAGAC 2 cut(s) 171, 230
BccI CCATC 2 cut(s) 33, 246
BciT130I CCWGG 2 cut(s) 124, 249
BcoDI GTCTC 3 cut(s) 72, 179, 294
BfaI CTAG 1 cut(s) 294
BfmI CTRYAG 1 cut(s) 228
Bme1390I CCNGG 2 cut(s) 124, 249
Bme18I GGWCC 1 cut(s) 255
BmgT120I GGNCC 1 cut(s) 255
BmiI GGNNCC 1 cut(s) 29
BmrFI CCNGG 2 cut(s) 124, 249
BmsI GCATC 1 cut(s) 323
BpiI GAAGAC 2 cut(s) 171, 230
BplI GAGNNNNNCTC 1 cut(s) 31
BpmI CTGGAG 2 cut(s) 139, 231
BpuEI CTTGAG 2 cut(s) 85, 176
BsaBI GATNNNNATC 1 cut(s) 313
BsaJI CCNNGG 2 cut(s) 18, 123
BsaXI ACNNNNNCTCC 2 cut(s) 41, 71
Bsc4I CCNNNNNNNGG 2 cut(s) 24, 105
Bse1I ACTGG 3 cut(s) 29, 40, 156
Bse8I GATNNNNATC 1 cut(s) 313
BseBI CCWGG 2 cut(s) 124, 249
BseDI CCNNGG 2 cut(s) 18, 123
BseGI GGATG 3 cut(s) 44, 257, 314
BseJI GATNNNNATC 1 cut(s) 313
BseLI CCNNNNNNNGG 2 cut(s) 24, 105
BseMII CTCAG 1 cut(s) 160
BseNI ACTGG 3 cut(s) 29, 40, 156
BseRI GAGGAG 1 cut(s) 20
BslI CCNNNNNNNGG 2 cut(s) 24, 105
BsmAI GTCTC 3 cut(s) 72, 179, 294
BspCNI CTCAG 1 cut(s) 159
BspHI TCATGA 1 cut(s) 160
BspLI GGNNCC 1 cut(s) 29
BsrI ACTGG 3 cut(s) 29, 40, 156
BssECI CCNNGG 2 cut(s) 18, 123
Bst2UI CCWGG 2 cut(s) 124, 249
Bst4CI ACNGT 2 cut(s) 46, 229
Bst6I CTCTTC 1 cut(s) 70
BstDEI CTNAG 1 cut(s) 146
BstF5I GGATG 3 cut(s) 44, 257, 314
BstMAI GTCTC 3 cut(s) 72, 179, 294
BstNI CCWGG 2 cut(s) 124, 249
BstSCI CCNGG 2 cut(s) 122, 247
BstSFI CTRYAG 1 cut(s) 228
BstV2I GAAGAC 2 cut(s) 171, 230
BstXI CCANNNNNNTGG 1 cut(s) 39
BtsCI GGATG 3 cut(s) 44, 257, 314
BtsIMutI CAGTG 1 cut(s) 51
CciI TCATGA 1 cut(s) 160
Cfr13I GGNCC 1 cut(s) 255
CviAII CATG 1 cut(s) 161
CviJI RGCY 2 cut(s) 28, 284
CviKI_1 RGCY 2 cut(s) 28, 284
DdeI CTNAG 1 cut(s) 146
Eam1104I CTCTTC 1 cut(s) 70
EarI CTCTTC 1 cut(s) 70
Eco32I GATATC 1 cut(s) 143
Eco47I GGWCC 1 cut(s) 255
Eco57I CTGAAG 1 cut(s) 186
EcoRII CCWGG 2 cut(s) 122, 247
EcoRV GATATC 1 cut(s) 143
FaeI CATG 1 cut(s) 164
FaiI YATR 2 cut(s) 111, 162
FatI CATG 1 cut(s) 160
FokI GGATG 3 cut(s) 51, 264, 321
FspBI CTAG 1 cut(s) 294
GsuI CTGGAG 2 cut(s) 139, 231
Hin1II CATG 1 cut(s) 164
HinfI GANTC 2 cut(s) 95, 187
Hpy188I TCNGA 3 cut(s) 19, 205, 270
Hpy188III TCNNGA 3 cut(s) 138, 161, 324
HpyAV CCTTC 2 cut(s) 210, 230
HpyCH4III ACNGT 2 cut(s) 46, 229
HpyCH4V TGCA 1 cut(s) 314
HpyF3I CTNAG 1 cut(s) 146
Hsp92II CATG 1 cut(s) 164
LmnI GCTCC 2 cut(s) 7, 33
LpnPI CCDG 7 cut(s) 10, 21, 109, 136, 169, 234, 261
LweI GCATC 1 cut(s) 323
MaeI CTAG 1 cut(s) 294
MboII GAAGA 3 cut(s) 87, 176, 235
MluCI AATT 2 cut(s) 177, 264
MlyI GAGTC 1 cut(s) 181
MnlI CCTC 6 cut(s) 13, 43, 109, 124, 163, 255
MseI TTAA 1 cut(s) 180
MspR9I CCNGG 2 cut(s) 124, 249
MvaI CCWGG 2 cut(s) 124, 249
NlaIII CATG 1 cut(s) 164
NlaIV GGNNCC 1 cut(s) 29
PagI TCATGA 1 cut(s) 160
PfeI GAWTC 1 cut(s) 95
PfoI TCCNGGA 1 cut(s) 247
PleI GAGTC 1 cut(s) 181
PpsI GAGTC 1 cut(s) 181
Psp6I CCWGG 2 cut(s) 122, 247
PspGI CCWGG 2 cut(s) 122, 247
PspN4I GGNNCC 1 cut(s) 29
PspPI GGNCC 1 cut(s) 255
SaqAI TTAA 1 cut(s) 180
Sau96I GGNCC 1 cut(s) 255
SchI GAGTC 1 cut(s) 181
ScrFI CCNGG 2 cut(s) 124, 249
SetI ASST 5 cut(s) 54, 135, 155, 202, 247
SfaNI GCATC 1 cut(s) 323
SfcI CTRYAG 1 cut(s) 228
SinI GGWCC 1 cut(s) 255
SmlI CTYRAG 2 cut(s) 100, 191
SmoI CTYRAG 2 cut(s) 100, 191
Sse9I AATT 2 cut(s) 177, 264
SspMI CTAG 1 cut(s) 294
StyD4I CCNGG 2 cut(s) 122, 247
TaaI ACNGT 2 cut(s) 46, 229
TaqI TCGA 1 cut(s) 139
TasI AATT 2 cut(s) 177, 264
TfiI GAWTC 1 cut(s) 95
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
TscAI CASTG 1 cut(s) 51
TspDTI ATGAA 1 cut(s) 177
TspRI CASTG 1 cut(s) 51
VpaK11BI GGWCC 1 cut(s) 255
XapI RAATTY 1 cut(s) 264
XspI CTAG 1 cut(s) 294
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.