pycom09g10140

Ubiquitin-like protein involved in cytoplasm to vacuole transport (Cvt) and autophagic vesicle formation

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Reverse (-)
8277529 .. 8279017
1489 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g10140.2

Sequence Viewer

Length: 288 bp
ATGGCTACCACGGAGTCTCAGGGTGCTGTTAAAAAAGTGGTTGTTCATCTGAGAGCTACTGGCGATGCTCCTATACTCAAGCAAACCAAATTCAAGATTCTTGGAACTGACAAGTTTGCTAAAGTGATTGAGTTTCTACGAAGGCAACTTCACAAGGAGACCTTGTTTGTATATGTAAACAGTGCATTCTCGCCGAACCCAGATGAATTGGTGATTGATCTGTATAATAATTTTGGTTTTGATGGTAAACTGGTGGTTAACTATGCTTGCTCCATGGCATGGGGCTGA

Protein Analysis

96

Amino Acids

10.65

Weight (kDa)

9.13

Isoelectric Point (pI)

44.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 279
AcsI RAATTY 1 cut(s) 89
AfiI CCNNNNNNNGG 1 cut(s) 279
AgsI TTSAA 1 cut(s) 94
AluBI AGCT 1 cut(s) 56
AluI AGCT 1 cut(s) 56
Alw26I GTCTC 2 cut(s) 21, 152
ApoI RAATTY 1 cut(s) 89
AsuHPI GGTGA 1 cut(s) 223
BccI CCATC 1 cut(s) 236
BcoDI GTCTC 2 cut(s) 21, 152
BmsI GCATC 1 cut(s) 55
BpuEI CTTGAG 1 cut(s) 62
BsaI GGTCTC 1 cut(s) 152
BsaJI CCNNGG 2 cut(s) 9, 273
BsaXI ACNNNNNCTCC 2 cut(s) 149, 179
Bsc4I CCNNNNNNNGG 1 cut(s) 279
Bse1I ACTGG 2 cut(s) 64, 255
BseDI CCNNGG 2 cut(s) 9, 273
BseLI CCNNNNNNNGG 1 cut(s) 279
BseMII CTCAG 2 cut(s) 32, 41
BseNI ACTGG 2 cut(s) 64, 255
BslI CCNNNNNNNGG 1 cut(s) 279
BsmAI GTCTC 2 cut(s) 21, 152
BsmI GAATGC 1 cut(s) 185
Bso31I GGTCTC 1 cut(s) 152
Bsp143I GATC 1 cut(s) 217
Bsp19I CCATGG 1 cut(s) 273
BspCNI CTCAG 2 cut(s) 31, 42
BspTNI GGTCTC 1 cut(s) 152
BsrI ACTGG 2 cut(s) 64, 255
BssECI CCNNGG 2 cut(s) 9, 273
BssMI GATC 1 cut(s) 217
BssT1I CCWWGG 1 cut(s) 273
Bst4CI ACNGT 1 cut(s) 182
BstC8I GCNNGC 1 cut(s) 268
BstDEI CTNAG 2 cut(s) 18, 50
BstDSI CCRYGG 2 cut(s) 9, 273
BstKTI GATC 1 cut(s) 220
BstMAI GTCTC 2 cut(s) 21, 152
BstMBI GATC 1 cut(s) 217
BtgI CCRYGG 2 cut(s) 9, 273
BtgZI GCGATG 1 cut(s) 78
BtsIMutI CAGTG 1 cut(s) 187
Cac8I GCNNGC 1 cut(s) 268
CviAII CATG 2 cut(s) 274, 279
CviJI RGCY 3 cut(s) 5, 56, 285
CviKI_1 RGCY 3 cut(s) 5, 56, 285
DdeI CTNAG 2 cut(s) 18, 50
DpnI GATC 1 cut(s) 219
DpnII GATC 1 cut(s) 217
Eco130I CCWWGG 1 cut(s) 273
Eco31I GGTCTC 1 cut(s) 152
EcoT14I CCWWGG 1 cut(s) 273
ErhI CCWWGG 1 cut(s) 273
FaeI CATG 2 cut(s) 277, 282
FaiI YATR 7 cut(s) 74, 172, 174, 225, 264, 275, 280
FalI AAGNNNNNCTT 2 cut(s) 146, 178
FatI CATG 2 cut(s) 273, 278
Hin1II CATG 2 cut(s) 277, 282
HincII GTYRAC 1 cut(s) 259
HindII GTYRAC 1 cut(s) 259
HinfI GANTC 2 cut(s) 14, 97
HpaI GTTAAC 1 cut(s) 259
HphI GGTGA 1 cut(s) 223
Hpy166II GTNNAC 3 cut(s) 178, 248, 259
Hpy188I TCNGA 1 cut(s) 51
Hpy188III TCNNGA 1 cut(s) 94
Hpy8I GTNNAC 3 cut(s) 178, 248, 259
HpyAV CCTTC 1 cut(s) 135
HpyCH4III ACNGT 1 cut(s) 182
HpyCH4V TGCA 1 cut(s) 185
HpyF3I CTNAG 2 cut(s) 18, 50
Hsp92II CATG 2 cut(s) 277, 282
KspAI GTTAAC 1 cut(s) 259
Kzo9I GATC 1 cut(s) 217
LmnI GCTCC 2 cut(s) 73, 275
LpnPI CCDG 4 cut(s) 5, 45, 213, 236
LweI GCATC 1 cut(s) 55
MalI GATC 1 cut(s) 219
MboI GATC 1 cut(s) 217
MluCI AATT 3 cut(s) 89, 206, 229
MlyI GAGTC 1 cut(s) 23
MseI TTAA 2 cut(s) 30, 258
Mva1269I GAATGC 1 cut(s) 185
NcoI CCATGG 1 cut(s) 273
NdeII GATC 1 cut(s) 217
NlaIII CATG 2 cut(s) 277, 282
PctI GAATGC 1 cut(s) 185
PfeI GAWTC 1 cut(s) 97
PflMI CCANNNNNTGG 1 cut(s) 279
PleI GAGTC 1 cut(s) 22
PpsI GAGTC 1 cut(s) 22
SaqAI TTAA 2 cut(s) 30, 258
Sau3AI GATC 1 cut(s) 217
SchI GAGTC 1 cut(s) 23
SetI ASST 2 cut(s) 58, 164
SfaNI GCATC 1 cut(s) 55
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
Sse9I AATT 3 cut(s) 89, 206, 229
StyI CCWWGG 1 cut(s) 273
TaaI ACNGT 1 cut(s) 182
TasI AATT 3 cut(s) 89, 206, 229
TfiI GAWTC 1 cut(s) 97
Tru1I TTAA 2 cut(s) 30, 258
Tru9I TTAA 2 cut(s) 30, 258
TscAI CASTG 1 cut(s) 187
TspDTI ATGAA 2 cut(s) 35, 219
TspGWI ACGGA 1 cut(s) 26
TspRI CASTG 1 cut(s) 187
Van91I CCANNNNNTGG 1 cut(s) 279
XapI RAATTY 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.