Rroxscaffold_1G00040070

Ubiquitin-like protein involved in cytoplasm to vacuole transport (Cvt) and autophagic vesicle formation

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
57703887 .. 57706248
2362 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00040070.1

Sequence Viewer

Length: 267 bp
ATGTCTATCACGGAATCTCCGACTACTGCTAAGAAAGTGGTTATTCATCTTAGAGCTACTAGTGATGCCCCTGTATTGAAGCAAGCGAAATTCAAGATACCTGTAACAAACAAATTTGCTAAAACTGACGGTCAATTATGCTTATACCATGGCATGGGGCTAACTATCAGGGCGGGGTTGGCAAACATACAACTATTGATAATGAGATCATCTCAACAGAATATAAATGAATTGAAGCATTATGGGCAGGCATTCATTGACAACTAG

Protein Analysis

88

Amino Acids

9.74

Weight (kDa)

9.84

Isoelectric Point (pI)

58.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 154
AciI CCGC 1 cut(s) 173
AcsI RAATTY 2 cut(s) 89, 113
AfiI CCNNNNNNNGG 1 cut(s) 154
AgsI TTSAA 3 cut(s) 79, 94, 235
AhlI ACTAGT 1 cut(s) 59
AluBI AGCT 1 cut(s) 56
AluI AGCT 1 cut(s) 56
ApoI RAATTY 2 cut(s) 89, 113
BcuI ACTAGT 1 cut(s) 59
BfaI CTAG 2 cut(s) 60, 265
BmsI GCATC 1 cut(s) 55
BplI GAGNNNNNCTC 2 cut(s) 196, 228
BsaJI CCNNGG 1 cut(s) 148
BsaXI ACNNNNNCTCC 1 cut(s) 31
Bsc4I CCNNNNNNNGG 1 cut(s) 154
BseDI CCNNGG 1 cut(s) 148
BseLI CCNNNNNNNGG 1 cut(s) 154
BslI CCNNNNNNNGG 1 cut(s) 154
BsmI GAATGC 1 cut(s) 251
Bsp143I GATC 1 cut(s) 206
Bsp19I CCATGG 1 cut(s) 148
BspACI CCGC 1 cut(s) 173
BssECI CCNNGG 1 cut(s) 148
BssMI GATC 1 cut(s) 206
BssT1I CCWWGG 1 cut(s) 148
Bst4CI ACNGT 1 cut(s) 131
BstC8I GCNNGC 2 cut(s) 84, 249
BstDEI CTNAG 2 cut(s) 30, 50
BstDSI CCRYGG 1 cut(s) 148
BstKTI GATC 1 cut(s) 209
BstMBI GATC 1 cut(s) 206
BstMWI GCNNNNNNNGC 2 cut(s) 179, 244
BtgI CCRYGG 1 cut(s) 148
Cac8I GCNNGC 2 cut(s) 84, 249
CviAII CATG 2 cut(s) 149, 154
CviJI RGCY 2 cut(s) 56, 160
CviKI_1 RGCY 2 cut(s) 56, 160
DdeI CTNAG 2 cut(s) 30, 50
DpnI GATC 1 cut(s) 208
DpnII GATC 1 cut(s) 206
Eco130I CCWWGG 1 cut(s) 148
EcoT14I CCWWGG 1 cut(s) 148
ErhI CCWWGG 1 cut(s) 148
FaeI CATG 2 cut(s) 152, 157
FaiI YATR 7 cut(s) 139, 145, 150, 155, 188, 224, 243
FatI CATG 2 cut(s) 148, 153
FauI CCCGC 1 cut(s) 166
FspBI CTAG 2 cut(s) 60, 265
Hin1II CATG 2 cut(s) 152, 157
HinfI GANTC 1 cut(s) 14
Hpy188I TCNGA 1 cut(s) 21
Hpy188III TCNNGA 1 cut(s) 94
HpyCH4III ACNGT 1 cut(s) 131
HpyF10VI GCNNNNNNNGC 2 cut(s) 179, 244
HpyF3I CTNAG 2 cut(s) 30, 50
Hsp92II CATG 2 cut(s) 152, 157
Kzo9I GATC 1 cut(s) 206
LpnPI CCDG 4 cut(s) 84, 114, 154, 233
LweI GCATC 1 cut(s) 55
MaeI CTAG 2 cut(s) 60, 265
MaeIII GTNAC 1 cut(s) 103
MalI GATC 1 cut(s) 208
MboI GATC 1 cut(s) 206
MluCI AATT 4 cut(s) 89, 113, 134, 230
MmeI TCCRAC 1 cut(s) 44
Mva1269I GAATGC 1 cut(s) 251
MwoI GCNNNNNNNGC 2 cut(s) 179, 244
NcoI CCATGG 1 cut(s) 148
NdeII GATC 1 cut(s) 206
NlaIII CATG 2 cut(s) 152, 157
PcsI WCGNNNNNNNCGW 1 cut(s) 17
PctI GAATGC 1 cut(s) 251
PfeI GAWTC 1 cut(s) 14
PflMI CCANNNNNTGG 1 cut(s) 154
Sau3AI GATC 1 cut(s) 206
SetI ASST 2 cut(s) 58, 103
SfaNI GCATC 1 cut(s) 55
SpeI ACTAGT 1 cut(s) 59
Sse9I AATT 4 cut(s) 89, 113, 134, 230
SsiI CCGC 1 cut(s) 173
SspMI CTAG 2 cut(s) 60, 265
StyI CCWWGG 1 cut(s) 148
TaaI ACNGT 1 cut(s) 131
TasI AATT 4 cut(s) 89, 113, 134, 230
TfiI GAWTC 1 cut(s) 14
TspDTI ATGAA 3 cut(s) 35, 243, 244
TspGWI ACGGA 1 cut(s) 26
Van91I CCANNNNNTGG 1 cut(s) 154
XapI RAATTY 2 cut(s) 89, 113
XspI CTAG 2 cut(s) 60, 265
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.