Rroxscaffold_1G00040780

Ubiquitin-like protein involved in cytoplasm to vacuole transport (Cvt) and autophagic vesicle formation

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
58552130 .. 58572651
20522 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00040780.1

Sequence Viewer

Length: 288 bp
ATGTCTATCACGGAATCTCCGACTACTGCTAAGAAAGTGGTTATTCATCTTAGAGCTACTAGTGATGCCCCTGTATTGAAGCAAGCGAAATTCAAGATACCTGTAACAAACAAATTTGCTAAAGTAATTAATTTTTTAAAGAGGCAACTTCACCAGGATACGTTGTTTGTGTATGTCAACAGTGCATTCTCTCCAAACCCAAATAAATTGGTGATGAATCTGTATAATAATTTTGGTTTTGATGGTAGACTGACGGTCAATTATGCTTATACCATGGCATGGGGCTAA

Protein Analysis

95

Amino Acids

10.78

Weight (kDa)

10.06

Isoelectric Point (pI)

39.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
APG12 PF04110 12 - 95 3e-30 Ubiquitin-like autophagy protein Apg12
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 279
AccI GTMKAC 1 cut(s) 247
AcsI RAATTY 2 cut(s) 89, 113
AfiI CCNNNNNNNGG 1 cut(s) 279
AgsI TTSAA 2 cut(s) 79, 94
AhdI GACNNNNNGTC 1 cut(s) 254
AhlI ACTAGT 1 cut(s) 59
AjnI CCWGG 1 cut(s) 153
AluBI AGCT 1 cut(s) 56
AluI AGCT 1 cut(s) 56
ApoI RAATTY 2 cut(s) 89, 113
AseI ATTAAT 1 cut(s) 129
AsuHPI GGTGA 2 cut(s) 143, 223
BccI CCATC 1 cut(s) 236
BciT130I CCWGG 1 cut(s) 155
BciVI GTATCC 1 cut(s) 151
BcuI ACTAGT 1 cut(s) 59
BfaI CTAG 1 cut(s) 60
BfuI GTATCC 1 cut(s) 151
Bme1390I CCNGG 1 cut(s) 155
BmeRI GACNNNNNGTC 1 cut(s) 254
BmrFI CCNGG 1 cut(s) 155
BmsI GCATC 1 cut(s) 55
BsaJI CCNNGG 1 cut(s) 273
BsaXI ACNNNNNCTCC 1 cut(s) 31
Bsc4I CCNNNNNNNGG 1 cut(s) 279
BseBI CCWGG 1 cut(s) 155
BseDI CCNNGG 1 cut(s) 273
BseLI CCNNNNNNNGG 1 cut(s) 279
BslI CCNNNNNNNGG 1 cut(s) 279
BsmI GAATGC 1 cut(s) 185
Bsp19I CCATGG 1 cut(s) 273
BssECI CCNNGG 1 cut(s) 273
BssT1I CCWWGG 1 cut(s) 273
Bst2UI CCWGG 1 cut(s) 155
Bst4CI ACNGT 2 cut(s) 182, 256
BstC8I GCNNGC 1 cut(s) 84
BstDEI CTNAG 2 cut(s) 30, 50
BstDSI CCRYGG 1 cut(s) 273
BstNI CCWGG 1 cut(s) 155
BstSCI CCNGG 1 cut(s) 153
BsuI GTATCC 1 cut(s) 151
BtgI CCRYGG 1 cut(s) 273
BtsIMutI CAGTG 1 cut(s) 187
Cac8I GCNNGC 1 cut(s) 84
CviAII CATG 2 cut(s) 274, 279
CviJI RGCY 2 cut(s) 56, 285
CviKI_1 RGCY 2 cut(s) 56, 285
DdeI CTNAG 2 cut(s) 30, 50
DraI TTTAAA 1 cut(s) 138
DriI GACNNNNNGTC 1 cut(s) 254
Eam1105I GACNNNNNGTC 1 cut(s) 254
Eco130I CCWWGG 1 cut(s) 273
EcoRII CCWGG 1 cut(s) 153
EcoT14I CCWWGG 1 cut(s) 273
ErhI CCWWGG 1 cut(s) 273
FaeI CATG 2 cut(s) 277, 282
FaiI YATR 6 cut(s) 174, 225, 264, 270, 275, 280
FatI CATG 2 cut(s) 273, 278
FblI GTMKAC 1 cut(s) 247
FspBI CTAG 1 cut(s) 60
Hin1II CATG 2 cut(s) 277, 282
HincII GTYRAC 1 cut(s) 178
HindII GTYRAC 1 cut(s) 178
HinfI GANTC 2 cut(s) 14, 217
HphI GGTGA 2 cut(s) 143, 223
Hpy166II GTNNAC 2 cut(s) 178, 248
Hpy188I TCNGA 1 cut(s) 21
Hpy188III TCNNGA 1 cut(s) 94
Hpy8I GTNNAC 2 cut(s) 178, 248
HpyCH4III ACNGT 2 cut(s) 182, 256
HpyCH4IV ACGT 1 cut(s) 161
HpyCH4V TGCA 1 cut(s) 185
HpyF3I CTNAG 2 cut(s) 30, 50
HpySE526I ACGT 1 cut(s) 161
Hsp92II CATG 2 cut(s) 277, 282
LpnPI CCDG 4 cut(s) 84, 114, 140, 167
LweI GCATC 1 cut(s) 55
MaeI CTAG 1 cut(s) 60
MaeII ACGT 1 cut(s) 161
MaeIII GTNAC 1 cut(s) 103
MluCI AATT 7 cut(s) 89, 113, 126, 130, 206, 229, 259
MmeI TCCRAC 1 cut(s) 44
MnlI CCTC 1 cut(s) 135
MseI TTAA 2 cut(s) 129, 137
MspR9I CCNGG 1 cut(s) 155
Mva1269I GAATGC 1 cut(s) 185
MvaI CCWGG 1 cut(s) 155
NcoI CCATGG 1 cut(s) 273
NlaIII CATG 2 cut(s) 277, 282
PcsI WCGNNNNNNNCGW 1 cut(s) 17
PctI GAATGC 1 cut(s) 185
PfeI GAWTC 2 cut(s) 14, 217
PflMI CCANNNNNTGG 1 cut(s) 279
PshBI ATTAAT 1 cut(s) 129
Psp6I CCWGG 1 cut(s) 153
PspGI CCWGG 1 cut(s) 153
SaqAI TTAA 2 cut(s) 129, 137
ScrFI CCNGG 1 cut(s) 155
SetI ASST 3 cut(s) 58, 103, 164
SfaNI GCATC 1 cut(s) 55
SgeI CNNG 8 cut(s) 22, 72, 83, 95, 106, 113, 166, 167
SpeI ACTAGT 1 cut(s) 59
Sse9I AATT 7 cut(s) 89, 113, 126, 130, 206, 229, 259
SspMI CTAG 1 cut(s) 60
StyD4I CCNGG 1 cut(s) 153
StyI CCWWGG 1 cut(s) 273
TaaI ACNGT 2 cut(s) 182, 256
TaiI ACGT 1 cut(s) 164
TasI AATT 7 cut(s) 89, 113, 126, 130, 206, 229, 259
TfiI GAWTC 2 cut(s) 14, 217
Tru1I TTAA 2 cut(s) 129, 137
Tru9I TTAA 2 cut(s) 129, 137
TscAI CASTG 1 cut(s) 187
TspDTI ATGAA 2 cut(s) 35, 230
TspGWI ACGGA 1 cut(s) 26
TspRI CASTG 1 cut(s) 187
Van91I CCANNNNNTGG 1 cut(s) 279
VspI ATTAAT 1 cut(s) 129
XapI RAATTY 2 cut(s) 89, 113
XmiI GTMKAC 1 cut(s) 247
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.