pycom11g03240
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
OG0008954
Physical Location & Seq
Forward (+)
2505666 .. 2505851
186 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g03240.1

Sequence Viewer

Length: 186 bp
ATGATGAAAGATGTCGTTGCAATGCTCAAGGAAATTCGACATGTAGACAGCGCAAGGCCGGAACCAGAGTTGTTAAAGGGAGGAGGGTTGCAATCAATTCTGGCATCCCCTCCTGCTAGGAGAGCAGTTTCACAAGGCTCTTCTAACTGCTCATTTGCTTTCTCTGAAGATTCAAGGTCTCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRRNT_2 LRR_1 LRR_8 Pkinase

Protein Analysis

62

Amino Acids

6.57

Weight (kDa)

7.96

Isoelectric Point (pI)

95.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 45
AcsI RAATTY 1 cut(s) 33
AcuI CTGAAG 1 cut(s) 186
AflIII ACRYGT 1 cut(s) 40
AgsI TTSAA 1 cut(s) 174
AoxI GGCC 1 cut(s) 56
ApoI RAATTY 1 cut(s) 33
AspLEI GCGC 1 cut(s) 53
BfaI CTAG 1 cut(s) 117
BmiI GGNNCC 1 cut(s) 63
BmsI GCATC 1 cut(s) 113
BpuEI CTTGAG 1 cut(s) 11
Bse3DI GCAATG 1 cut(s) 27
BseGI GGATG 1 cut(s) 104
BseMI GCAATG 1 cut(s) 27
BseRI GAGGAG 1 cut(s) 96
BshFI GGCC 1 cut(s) 58
BsiSI CCGG 1 cut(s) 59
BsnI GGCC 1 cut(s) 58
BspANI GGCC 1 cut(s) 58
BspLI GGNNCC 1 cut(s) 63
BspQI GCTCTTC 1 cut(s) 145
BsrDI GCAATG 1 cut(s) 27
Bst6I CTCTTC 1 cut(s) 145
BstF5I GGATG 1 cut(s) 104
BstHHI GCGC 1 cut(s) 53
BstMWI GCNNNNNNNGC 1 cut(s) 122
BstNSI RCATGY 1 cut(s) 44
BsuRI GGCC 1 cut(s) 58
BtsCI GGATG 1 cut(s) 104
CfoI GCGC 1 cut(s) 53
CviAII CATG 1 cut(s) 41
CviJI RGCY 2 cut(s) 58, 138
CviKI_1 RGCY 2 cut(s) 58, 138
Eam1104I CTCTTC 1 cut(s) 145
EarI CTCTTC 1 cut(s) 145
Eco57I CTGAAG 1 cut(s) 186
FaeI CATG 1 cut(s) 44
FaiI YATR 1 cut(s) 42
FatI CATG 1 cut(s) 40
FblI GTMKAC 1 cut(s) 45
FokI GGATG 1 cut(s) 91
FspBI CTAG 1 cut(s) 117
GlaI GCGC 1 cut(s) 52
HaeIII GGCC 1 cut(s) 58
HapII CCGG 1 cut(s) 59
HhaI GCGC 1 cut(s) 53
Hin1II CATG 1 cut(s) 44
Hin6I GCGC 1 cut(s) 51
HinP1I GCGC 1 cut(s) 51
HinfI GANTC 1 cut(s) 170
HpaII CCGG 1 cut(s) 59
Hpy166II GTNNAC 1 cut(s) 46
Hpy188I TCNGA 1 cut(s) 166
Hpy8I GTNNAC 1 cut(s) 46
HpyCH4V TGCA 2 cut(s) 20, 91
HpyF10VI GCNNNNNNNGC 1 cut(s) 122
Hsp92II CATG 1 cut(s) 44
HspAI GCGC 1 cut(s) 51
LguI GCTCTTC 1 cut(s) 145
LpnPI CCDG 4 cut(s) 72, 78, 86, 126
LweI GCATC 1 cut(s) 113
MaeI CTAG 1 cut(s) 117
MboII GAAGA 2 cut(s) 132, 179
MluCI AATT 2 cut(s) 33, 96
MnlI CCTC 3 cut(s) 74, 77, 120
MseI TTAA 1 cut(s) 74
MspI CCGG 1 cut(s) 59
MwoI GCNNNNNNNGC 1 cut(s) 122
NlaIII CATG 1 cut(s) 44
NlaIV GGNNCC 1 cut(s) 63
NspI RCATGY 1 cut(s) 44
PciI ACATGT 1 cut(s) 40
PciSI GCTCTTC 1 cut(s) 145
PfeI GAWTC 1 cut(s) 170
PscI ACATGT 1 cut(s) 40
PspN4I GGNNCC 1 cut(s) 63
SapI GCTCTTC 1 cut(s) 145
SaqAI TTAA 1 cut(s) 74
SetI ASST 1 cut(s) 179
SfaNI GCATC 1 cut(s) 113
SgeI CNNG 9 cut(s) 40, 53, 66, 71, 77, 113, 125, 129, 146
SmlI CTYRAG 1 cut(s) 26
SmoI CTYRAG 1 cut(s) 26
Sse9I AATT 2 cut(s) 33, 96
SspMI CTAG 1 cut(s) 117
TaqI TCGA 1 cut(s) 37
TasI AATT 2 cut(s) 33, 96
TfiI GAWTC 1 cut(s) 170
Tru1I TTAA 1 cut(s) 74
Tru9I TTAA 1 cut(s) 74
TspDTI ATGAA 1 cut(s) 20
XapI RAATTY 1 cut(s) 33
XceI RCATGY 1 cut(s) 44
XmiI GTMKAC 1 cut(s) 45
XspI CTAG 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.