pycom11g09630

Belongs to the universal ribosomal protein uL23 family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Reverse (-)
7900045 .. 7902084
2040 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 462 bp
ATGGCTCCACCTAAAGCTAATGTTTCAAAAAAGGCTGACCCAAAGTCACAAGCCGTGAAGGCTGCAAGGGCTTTGAAATCTGGCCCTGCTGTTAAAAAAGTTAAGAAGATCAGAACCTCAGTTACATTTCACCGCCCTAGGACATTGAAAAAGGAGAGGAACCCTAAGTACCCTCGTATTAGTGCTACACCGAGGAACAAGCTTGATCATTATCAAATATTGAAATATCCTCTTACCACTGAGTCTGCAATGAAGAAGATTGAAGATAACAACACTTTGGTCTTTATTGTTGACATACGTGCTGACAAGAAGAAAATCAAGGATGCAGTCAAGAAGATGTACGACATTCAGACCAAGAAAGTGAATACCCTGATCAGGCCCGATGGTACCAAAAAGGCTTATGTTAGGCTAACCCCTGACTACGATGCTTTGGATGTGGCAAACAAAATCGGTATCATCTAA

Protein Analysis

154

Amino Acids

17.35

Weight (kDa)

10.31

Isoelectric Point (pI)

27.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L23eN PF03939 14 - 62 4.5e-18 Ribosomal protein L23, N-terminal domain
Ribosomal_L23 PF00276 72 - 133 7.3e-14 Ribosomal protein L23
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 386
AccB1I GGYRCC 1 cut(s) 386
AciI CCGC 1 cut(s) 133
AfaI GTAC 3 cut(s) 170, 341, 388
AfiI CCNNNNNNNGG 1 cut(s) 375
AgsI TTSAA 5 cut(s) 27, 76, 148, 223, 263
AhdI GACNNNNNGTC 1 cut(s) 43
AluBI AGCT 2 cut(s) 17, 202
AluI AGCT 2 cut(s) 17, 202
AoxI GGCC 2 cut(s) 82, 377
ApeKI GCWGC 1 cut(s) 62
Asp718I GGTACC 1 cut(s) 386
AspA2I CCTAGG 1 cut(s) 137
AspS9I GGNCC 2 cut(s) 83, 378
AsuHPI GGTGA 1 cut(s) 122
AvrII CCTAGG 1 cut(s) 137
BanI GGYRCC 1 cut(s) 386
BbvI GCAGC 1 cut(s) 49
BccI CCATC 1 cut(s) 377
BceAI ACGGC 1 cut(s) 38
BclI TGATCA 2 cut(s) 205, 372
BfaI CTAG 1 cut(s) 138
BglI GCCNNNNNGGC 1 cut(s) 59
BisI GCNGC 1 cut(s) 63
BlnI CCTAGG 1 cut(s) 137
BlsI GCNGC 1 cut(s) 64
BmeRI GACNNNNNGTC 1 cut(s) 43
BmgT120I GGNCC 2 cut(s) 83, 378
BmiI GGNNCC 3 cut(s) 6, 161, 388
BmsI GCATC 2 cut(s) 313, 415
BsaAI YACGTR 1 cut(s) 299
BsaBI GATNNNNATC 1 cut(s) 210
BsaJI CCNNGG 2 cut(s) 137, 191
Bsc4I CCNNNNNNNGG 1 cut(s) 375
Bse3DI GCAATG 1 cut(s) 255
Bse8I GATNNNNATC 1 cut(s) 210
BseDI CCNNGG 2 cut(s) 137, 191
BseGI GGATG 2 cut(s) 328, 439
BseJI GATNNNNATC 1 cut(s) 210
BseLI CCNNNNNNNGG 1 cut(s) 375
BseMI GCAATG 1 cut(s) 255
BseMII CTCAG 2 cut(s) 132, 231
BseXI GCAGC 1 cut(s) 49
BshFI GGCC 2 cut(s) 84, 379
BshNI GGYRCC 1 cut(s) 386
BslI CCNNNNNNNGG 1 cut(s) 375
BsnI GGCC 2 cut(s) 84, 379
Bsp143I GATC 3 cut(s) 108, 205, 372
BspACI CCGC 1 cut(s) 133
BspANI GGCC 2 cut(s) 84, 379
BspCNI CTCAG 2 cut(s) 131, 232
BspLI GGNNCC 3 cut(s) 6, 161, 388
BspT107I GGYRCC 1 cut(s) 386
BsrDI GCAATG 1 cut(s) 255
BssECI CCNNGG 2 cut(s) 137, 191
BssMI GATC 3 cut(s) 108, 205, 372
BssT1I CCWWGG 1 cut(s) 137
BstBAI YACGTR 1 cut(s) 299
BstDEI CTNAG 3 cut(s) 118, 165, 240
BstF5I GGATG 2 cut(s) 328, 439
BstKTI GATC 3 cut(s) 111, 208, 375
BstMBI GATC 3 cut(s) 108, 205, 372
BstMWI GCNNNNNNNGC 2 cut(s) 59, 68
BstV1I GCAGC 1 cut(s) 49
BsuRI GGCC 2 cut(s) 84, 379
BtsCI GGATG 2 cut(s) 328, 439
BtsIMutI CAGTG 1 cut(s) 237
Cfr13I GGNCC 2 cut(s) 83, 378
Csp6I GTAC 3 cut(s) 169, 340, 387
CviQI GTAC 3 cut(s) 169, 340, 387
DdeI CTNAG 3 cut(s) 118, 165, 240
DpnI GATC 3 cut(s) 110, 207, 374
DpnII GATC 3 cut(s) 108, 205, 372
DriI GACNNNNNGTC 1 cut(s) 43
Eam1105I GACNNNNNGTC 1 cut(s) 43
Eco130I CCWWGG 1 cut(s) 137
EcoT14I CCWWGG 1 cut(s) 137
ErhI CCWWGG 1 cut(s) 137
FaiI YATR 2 cut(s) 296, 402
FbaI TGATCA 2 cut(s) 205, 372
Fnu4HI GCNGC 1 cut(s) 63
FokI GGATG 2 cut(s) 335, 446
Fsp4HI GCNGC 1 cut(s) 63
FspBI CTAG 1 cut(s) 138
GluI GCNGC 1 cut(s) 63
HaeIII GGCC 2 cut(s) 84, 379
HincII GTYRAC 1 cut(s) 292
HindII GTYRAC 1 cut(s) 292
HindIII AAGCTT 1 cut(s) 200
HinfI GANTC 1 cut(s) 242
HphI GGTGA 1 cut(s) 122
Hpy166II GTNNAC 1 cut(s) 292
Hpy188I TCNGA 2 cut(s) 113, 351
Hpy188III TCNNGA 1 cut(s) 331
Hpy8I GTNNAC 1 cut(s) 292
HpyAV CCTTC 1 cut(s) 52
HpyCH4IV ACGT 1 cut(s) 298
HpyCH4V TGCA 3 cut(s) 65, 248, 326
HpyF10VI GCNNNNNNNGC 2 cut(s) 59, 68
HpyF3I CTNAG 3 cut(s) 118, 165, 240
HpySE526I ACGT 1 cut(s) 298
KpnI GGTACC 1 cut(s) 390
Ksp22I TGATCA 2 cut(s) 205, 372
Kzo9I GATC 3 cut(s) 108, 205, 372
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 5 cut(s) 66, 99, 361, 383, 429
Lsp1109I GCAGC 1 cut(s) 49
LweI GCATC 2 cut(s) 313, 415
MaeI CTAG 1 cut(s) 138
MaeII ACGT 1 cut(s) 298
MaeIII GTNAC 2 cut(s) 45, 121
MalI GATC 3 cut(s) 110, 207, 374
MboI GATC 3 cut(s) 108, 205, 372
MboII GAAGA 6 cut(s) 118, 265, 268, 275, 322, 346
MlyI GAGTC 1 cut(s) 251
MnlI CCTC 5 cut(s) 127, 150, 183, 186, 240
MseI TTAA 2 cut(s) 93, 102
MwoI GCNNNNNNNGC 2 cut(s) 59, 68
NdeII GATC 3 cut(s) 108, 205, 372
NlaIV GGNNCC 3 cut(s) 6, 161, 388
NmuCI GTSAC 1 cut(s) 45
PkrI GCNGC 1 cut(s) 64
PleI GAGTC 1 cut(s) 250
PpsI GAGTC 1 cut(s) 250
Ppu21I YACGTR 1 cut(s) 299
PspN4I GGNNCC 3 cut(s) 6, 161, 388
PspPI GGNCC 2 cut(s) 83, 378
PsrI GAACNNNNNNTAC 4 cut(s) 106, 138, 152, 184
RsaI GTAC 3 cut(s) 170, 341, 388
RsaNI GTAC 3 cut(s) 169, 340, 387
SaqAI TTAA 2 cut(s) 93, 102
SatI GCNGC 1 cut(s) 63
Sau3AI GATC 3 cut(s) 108, 205, 372
Sau96I GGNCC 2 cut(s) 83, 378
SchI GAGTC 1 cut(s) 251
SetI ASST 5 cut(s) 13, 19, 119, 204, 301
SfaNI GCATC 2 cut(s) 313, 415
SsiI CCGC 1 cut(s) 133
SspI AATATT 1 cut(s) 219
SspMI CTAG 1 cut(s) 138
StyI CCWWGG 1 cut(s) 137
TaiI ACGT 1 cut(s) 301
Tru1I TTAA 2 cut(s) 93, 102
Tru9I TTAA 2 cut(s) 93, 102
TscAI CASTG 1 cut(s) 244
TseFI GTSAC 1 cut(s) 45
TseI GCWGC 1 cut(s) 62
Tsp45I GTSAC 1 cut(s) 45
TspDTI ATGAA 1 cut(s) 266
TspRI CASTG 1 cut(s) 244
XmaJI CCTAGG 1 cut(s) 137
XspI CTAG 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.