pycom11g22760
BZIP Family

transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
OG0015705
Physical Location & Seq
Reverse (-)
25747066 .. 25748966
1901 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g22760.3

Sequence Viewer

Length: 1062 bp
ATGGCACAATTACCTCCTAAAATACCAAGCATGACACAAAATTGGCCATCCTTCCCTCACCAAAGGCTACCCGCCATGGCCAATTTCATCCCCACCACGACGACCACTTCTGCCGCCGCAATTCAACCCTCGTCCAACCAACCGAACCAACAACAACAATCCTCGTCGTGCAATTGGATGGACGAGTTCCTCGACTTCTCCTCCGCCAGGCGCGGGGCCCATCGGAGGTCTGCAAGCGACTCCATTGCCTTTCTCGAGTCCCCGTTGATACTTGACGAGGAATGCAGGAATCCTACCGCCACCATGATGCATCATCACGGATCGACCAACAACCTCGGCTTCGATAGACTAGACGACGAGCAGCTCATGTCCATGTTCTCCGACGACATGTCCGTGACCGTGCCACCTACCATCTCGTCGTCCAACCCGTCCACGCCGTCCGACCAGAACAGCAATAACAACGAGAACAATATTAATAATGGCAATAATAATAACATGAAGCCATTGATGCTTCATTTGGACCAGCAGCAGCAGCCTAAAACGGAGCCCGGAGAGGTTGAAAGCTCGTCGTGCGAGGCTGACGCTAATGCTCAATCTCATCCGCCACCGCCCACCTCCCCGGCTGACCCCAAGAGGGTCAAAAGGATTTTGGCAAACCGGCAATCAGCACAGAGGTCGAGAGTGAGAAAATTGCAATATATTTCGGAGCTTGAGCGCAGCGTTACAACATTACAGGTATCGGCGCTGTCACCAAGGGTTGCATTTCTAGACCACCAAAGGTTGATTCTAAACGTTGATAATAGTGCTCTCAAGCAACGGATTGCTGCTTTGGCTCAAGACAAGCTTTTCAAAGATGCTCATCAAGAGGCACTAAAGAAGGAAATAGAGAGGTTAAGGCAGGTCTATCACCACCAAACCCTAAAGAAGATGGACAACCAAGGAAACCGAAACCAAAACGCTCAACAGCATCAACAGCATCAACAGCAGCAGCAGCAGCAGCAGCAATCAAACCCAGACATCATGGTCTGTACGGATCACAATGAGCAGCAAATTCCCAATTGA

Protein Analysis

354

Amino Acids

39.87

Weight (kDa)

6.53

Isoelectric Point (pI)

68.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015705)

Species Orthologous Gene IDs
malus_domestica MD03G1237600.v1.1 MD11G1258200.v1.1
prunus_persica Prupe.4G172000_v2.0.a1 Prupe.4G172000_v2.0.a1
pyrus_communis pycom03g18330 pycom11g22760
rosa_chinensis RchiOBHm_Chr5g0031811
rosa_laevigata RLG00000033348
rosa_multiflora Rmu_sc0006847.1_g000027
rosa_roxburghii Rroxscaffold_1G00048460
rosa_rugosa Rorug05G0127700
rosa_samantha Rh5AG222000 Rh5BG222000 Rh5CG245300 Rh5DG226900
rosa_wichuraiana Rw5G020240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 1022
Acc36I ACCTGC 1 cut(s) 889
AccII CGCG 1 cut(s) 213
AciI CCGC 8 cut(s) 72, 114, 117, 204, 213, 297, 602, 608
AclI AACGTT 1 cut(s) 792
AclWI GGATC 2 cut(s) 328, 1041
AcoI YGGCCR 2 cut(s) 44, 78
AcsI RAATTY 1 cut(s) 1050
AfaI GTAC 1 cut(s) 1030
AfiI CCNNNNNNNGG 4 cut(s) 207, 213, 225, 634
AflIII ACRYGT 1 cut(s) 387
AgsI TTSAA 3 cut(s) 125, 560, 850
AhdI GACNNNNNGTC 1 cut(s) 388
AjnI CCWGG 1 cut(s) 206
AjuI GAANNNNNNNTTGG 2 cut(s) 768, 800
AluBI AGCT 4 cut(s) 364, 564, 709, 844
AluI AGCT 4 cut(s) 364, 564, 709, 844
Alw21I GWGCWC 1 cut(s) 808
AlwI GGATC 2 cut(s) 328, 1041
Ama87I CYCGRG 1 cut(s) 254
AoxI GGCC 3 cut(s) 44, 78, 216
ApaI GGGCCC 1 cut(s) 220
ApoI RAATTY 1 cut(s) 1050
AseI ATTAAT 1 cut(s) 474
AspLEI GCGC 3 cut(s) 213, 717, 745
AspS9I GGNCC 3 cut(s) 216, 217, 520
AsuC2I CCSGG 2 cut(s) 549, 620
AsuHPI GGTGA 3 cut(s) 50, 741, 899
AvaI CYCGRG 1 cut(s) 254
AvaII GGWCC 1 cut(s) 520
BaeGI GKGCMC 1 cut(s) 220
BalI TGGCCA 2 cut(s) 46, 80
BanII GRGCYC 2 cut(s) 220, 549
Bbv12I GWGCWC 1 cut(s) 808
BccI CCATC 5 cut(s) 55, 172, 228, 419, 922
BceAI ACGGC 1 cut(s) 421
BcgI CGANNNNNNTGC 4 cut(s) 227, 261, 657, 691
BciT130I CCWGG 1 cut(s) 208
BcnI CCSGG 2 cut(s) 549, 620
BfaI CTAG 2 cut(s) 350, 767
BfoI RGCGCY 1 cut(s) 746
BfuAI ACCTGC 1 cut(s) 889
Bme1390I CCNGG 3 cut(s) 208, 549, 620
Bme18I GGWCC 1 cut(s) 520
BmeRI GACNNNNNGTC 1 cut(s) 388
BmeT110I CYCGRG 1 cut(s) 254
BmgT120I GGNCC 3 cut(s) 216, 217, 520
BmiI GGNNCC 3 cut(s) 217, 218, 546
BmrFI CCNGG 3 cut(s) 208, 549, 620
BmsI GCATC 6 cut(s) 297, 319, 498, 844, 976, 985
BpuEI CTTGAG 3 cut(s) 731, 794, 819
BpuMI CCSGG 2 cut(s) 549, 620
BsaBI GATNNNNATC 1 cut(s) 858
BsaJI CCNNGG 5 cut(s) 75, 334, 618, 752, 937
BsaXI ACNNNNNCTCC 2 cut(s) 185, 215
Bsc4I CCNNNNNNNGG 4 cut(s) 207, 213, 225, 634
Bse118I RCCGGY 1 cut(s) 657
Bse3DI GCAATG 1 cut(s) 243
Bse8I GATNNNNATC 1 cut(s) 858
BseBI CCWGG 1 cut(s) 208
BseDI CCNNGG 5 cut(s) 75, 334, 618, 752, 937
BseGI GGATG 4 cut(s) 47, 87, 183, 598
BseJI GATNNNNATC 1 cut(s) 858
BseLI CCNNNNNNNGG 4 cut(s) 207, 213, 225, 634
BseMI GCAATG 1 cut(s) 243
BseRI GAGGAG 1 cut(s) 190
BseSI GKGCMC 1 cut(s) 220
Bsh1236I CGCG 1 cut(s) 213
BshFI GGCC 3 cut(s) 46, 80, 218
BsiHKAI GWGCWC 1 cut(s) 808
BsiHKCI CYCGRG 1 cut(s) 254
BsiSI CCGG 3 cut(s) 549, 620, 658
BslFI GGGAC 1 cut(s) 244
BslI CCNNNNNNNGG 4 cut(s) 207, 213, 225, 634
BsmFI GGGAC 1 cut(s) 244
BsmI GAATGC 1 cut(s) 287
BsnI GGCC 3 cut(s) 46, 80, 218
BsoBI CYCGRG 1 cut(s) 254
Bsp120I GGGCCC 1 cut(s) 216
Bsp1286I GDGCHC 3 cut(s) 220, 549, 808
Bsp143I GATC 2 cut(s) 320, 1033
Bsp19I CCATGG 1 cut(s) 75
BspACI CCGC 8 cut(s) 72, 114, 117, 204, 213, 297, 602, 608
BspANI GGCC 3 cut(s) 46, 80, 218
BspFNI CGCG 1 cut(s) 213
BspLI GGNNCC 3 cut(s) 217, 218, 546
BspMI ACCTGC 1 cut(s) 889
BspPI GGATC 2 cut(s) 328, 1041
BsrDI GCAATG 1 cut(s) 243
BsrFI RCCGGY 1 cut(s) 657
BssAI RCCGGY 1 cut(s) 657
BssECI CCNNGG 5 cut(s) 75, 334, 618, 752, 937
BssMI GATC 2 cut(s) 320, 1033
BssT1I CCWWGG 3 cut(s) 75, 752, 937
Bst2UI CCWGG 1 cut(s) 208
Bst4CI ACNGT 1 cut(s) 400
BstC8I GCNNGC 1 cut(s) 235
BstDSI CCRYGG 1 cut(s) 75
BstENI CCTNNNNNAGG 1 cut(s) 205
BstF5I GGATG 4 cut(s) 47, 87, 183, 598
BstFNI CGCG 1 cut(s) 213
BstH2I RGCGCY 1 cut(s) 746
BstHHI GCGC 3 cut(s) 213, 717, 745
BstKTI GATC 2 cut(s) 323, 1036
BstMBI GATC 2 cut(s) 320, 1033
BstNI CCWGG 1 cut(s) 208
BstNSI RCATGY 1 cut(s) 391
BstSCI CCNGG 3 cut(s) 206, 547, 618
BstSLI GKGCMC 1 cut(s) 220
BstUI CGCG 1 cut(s) 213
BsuRI GGCC 3 cut(s) 46, 80, 218
BtgI CCRYGG 1 cut(s) 75
BtsCI GGATG 4 cut(s) 47, 87, 183, 598
BveI ACCTGC 1 cut(s) 889
Cac8I GCNNGC 1 cut(s) 235
CfoI GCGC 3 cut(s) 213, 717, 745
Cfr10I RCCGGY 1 cut(s) 657
Cfr13I GGNCC 3 cut(s) 216, 217, 520
CseI GACGC 1 cut(s) 590
Csp6I GTAC 1 cut(s) 1029
CviAII CATG 8 cut(s) 31, 76, 304, 367, 373, 388, 496, 1021
CviQI GTAC 1 cut(s) 1029
DpnI GATC 2 cut(s) 322, 1035
DpnII GATC 2 cut(s) 320, 1033
DrdI GACNNNNNNGTC 1 cut(s) 1022
DriI GACNNNNNGTC 1 cut(s) 388
DseDI GACNNNNNNGTC 1 cut(s) 1022
EaeI YGGCCR 2 cut(s) 44, 78
Eam1105I GACNNNNNGTC 1 cut(s) 388
EciI GGCGGA 2 cut(s) 193, 591
Eco130I CCWWGG 3 cut(s) 75, 752, 937
Eco24I GRGCYC 2 cut(s) 220, 549
Eco47I GGWCC 1 cut(s) 520
Eco88I CYCGRG 1 cut(s) 254
EcoNI CCTNNNNNAGG 1 cut(s) 205
EcoO109I RGGNCCY 1 cut(s) 216
EcoRII CCWGG 1 cut(s) 206
EcoT14I CCWWGG 3 cut(s) 75, 752, 937
EcoT22I ATGCAT 1 cut(s) 312
EcoT38I GRGCYC 2 cut(s) 220, 549
ErhI CCWWGG 3 cut(s) 75, 752, 937
FaeI CATG 8 cut(s) 34, 79, 307, 370, 376, 391, 499, 1024
FaiI YATR 9 cut(s) 32, 77, 305, 368, 374, 389, 497, 699, 1022
FalI AAGNNNNNCTT 2 cut(s) 828, 860
FaqI GGGAC 1 cut(s) 244
FatI CATG 8 cut(s) 30, 75, 303, 366, 372, 387, 495, 1020
FauI CCCGC 2 cut(s) 79, 206
FokI GGATG 4 cut(s) 34, 74, 190, 585
FriOI GRGCYC 2 cut(s) 220, 549
FspBI CTAG 2 cut(s) 350, 767
GlaI GCGC 3 cut(s) 212, 716, 744
HaeII RGCGCY 1 cut(s) 746
HaeIII GGCC 3 cut(s) 46, 80, 218
HapII CCGG 3 cut(s) 549, 620, 658
HgaI GACGC 1 cut(s) 590
HhaI GCGC 3 cut(s) 213, 717, 745
Hin1II CATG 8 cut(s) 34, 79, 307, 370, 376, 391, 499, 1024
Hin6I GCGC 3 cut(s) 211, 715, 743
HinP1I GCGC 3 cut(s) 211, 715, 743
HindIII AAGCTT 1 cut(s) 842
HinfI GANTC 4 cut(s) 239, 257, 289, 784
HpaII CCGG 3 cut(s) 549, 620, 658
HphI GGTGA 3 cut(s) 50, 741, 899
Hpy166II GTNNAC 1 cut(s) 432
Hpy188I TCNGA 4 cut(s) 225, 382, 442, 706
Hpy188III TCNNGA 5 cut(s) 254, 678, 767, 836, 863
Hpy8I GTNNAC 1 cut(s) 432
Hpy99I CGWCG 6 cut(s) 103, 169, 359, 386, 421, 571
HpyAV CCTTC 2 cut(s) 61, 871
HpyCH4III ACNGT 1 cut(s) 400
HpyCH4IV ACGT 1 cut(s) 792
HpyCH4V TGCA 6 cut(s) 171, 233, 285, 310, 694, 761
HpySE526I ACGT 1 cut(s) 792
Hsp92II CATG 8 cut(s) 34, 79, 307, 370, 376, 391, 499, 1024
HspAI GCGC 3 cut(s) 211, 715, 743
Kzo9I GATC 2 cut(s) 320, 1033
LmnI GCTCC 2 cut(s) 544, 706
LweI GCATC 6 cut(s) 297, 319, 498, 844, 976, 985
MaeI CTAG 2 cut(s) 350, 767
MaeII ACGT 1 cut(s) 792
MaeIII GTNAC 3 cut(s) 394, 721, 747
MalI GATC 2 cut(s) 322, 1035
MboI GATC 2 cut(s) 320, 1033
MboII GAAGA 1 cut(s) 937
MfeI CAATTG 2 cut(s) 172, 1057
MhlI GDGCHC 3 cut(s) 220, 549, 808
MlsI TGGCCA 2 cut(s) 46, 80
MluCI AATT 8 cut(s) 8, 40, 82, 120, 172, 689, 1050, 1057
MluNI TGGCCA 2 cut(s) 46, 80
MlyI GAGTC 2 cut(s) 233, 266
MmeI TCCRAC 4 cut(s) 159, 405, 447, 465
Mox20I TGGCCA 2 cut(s) 46, 80
Mph1103I ATGCAT 1 cut(s) 312
MscI TGGCCA 2 cut(s) 46, 80
MseI TTAA 2 cut(s) 474, 893
MslI CAYNNNNRTG 3 cut(s) 305, 371, 392
Msp20I TGGCCA 2 cut(s) 46, 80
MspI CCGG 3 cut(s) 549, 620, 658
MspR9I CCNGG 3 cut(s) 208, 549, 620
MunI CAATTG 2 cut(s) 172, 1057
Mva1269I GAATGC 1 cut(s) 287
MvaI CCWGG 1 cut(s) 208
MvnI CGCG 1 cut(s) 213
NciI CCSGG 2 cut(s) 549, 620
NcoI CCATGG 1 cut(s) 75
NdeII GATC 2 cut(s) 320, 1033
NlaIII CATG 8 cut(s) 34, 79, 307, 370, 376, 391, 499, 1024
NlaIV GGNNCC 3 cut(s) 217, 218, 546
NmeAIII GCCGAG 1 cut(s) 315
NmuCI GTSAC 2 cut(s) 394, 747
NsiI ATGCAT 1 cut(s) 312
NspI RCATGY 1 cut(s) 391
PaeR7I CTCGAG 1 cut(s) 254
PciI ACATGT 1 cut(s) 387
PcsI WCGNNNNNNNCGW 3 cut(s) 189, 390, 425
PctI GAATGC 1 cut(s) 287
PfeI GAWTC 2 cut(s) 289, 784
PleI GAGTC 2 cut(s) 233, 265
PpsI GAGTC 2 cut(s) 233, 265
PscI ACATGT 1 cut(s) 387
PshBI ATTAAT 1 cut(s) 474
Psp1406I AACGTT 1 cut(s) 792
Psp6I CCWGG 1 cut(s) 206
PspGI CCWGG 1 cut(s) 206
PspN4I GGNNCC 3 cut(s) 217, 218, 546
PspOMI GGGCCC 1 cut(s) 216
PspPI GGNCC 3 cut(s) 216, 217, 520
RsaI GTAC 1 cut(s) 1030
RsaNI GTAC 1 cut(s) 1029
RseI CAYNNNNRTG 3 cut(s) 305, 371, 392
SaqAI TTAA 2 cut(s) 474, 893
Sau3AI GATC 2 cut(s) 320, 1033
Sau96I GGNCC 3 cut(s) 216, 217, 520
SchI GAGTC 2 cut(s) 233, 266
ScrFI CCNGG 3 cut(s) 208, 549, 620
SduI GDGCHC 3 cut(s) 220, 549, 808
SfaNI GCATC 6 cut(s) 297, 319, 498, 844, 976, 985
Sfr274I CTCGAG 1 cut(s) 254
SinI GGWCC 1 cut(s) 520
SlaI CTCGAG 1 cut(s) 254
SmiMI CAYNNNNRTG 3 cut(s) 305, 371, 392
SmlI CTYRAG 4 cut(s) 254, 710, 809, 834
SmoI CTYRAG 4 cut(s) 254, 710, 809, 834
Sse9I AATT 8 cut(s) 8, 40, 82, 120, 172, 689, 1050, 1057
SsiI CCGC 8 cut(s) 72, 114, 117, 204, 213, 297, 602, 608
SspI AATATT 1 cut(s) 472
SspMI CTAG 2 cut(s) 350, 767
StyD4I CCNGG 3 cut(s) 206, 547, 618
StyI CCWWGG 3 cut(s) 75, 752, 937
TaaI ACNGT 1 cut(s) 400
TaiI ACGT 1 cut(s) 795
TaqI TCGA 5 cut(s) 192, 255, 323, 342, 677
TasI AATT 8 cut(s) 8, 40, 82, 120, 172, 689, 1050, 1057
TauI GCSGC 2 cut(s) 116, 119
TfiI GAWTC 2 cut(s) 289, 784
Tru1I TTAA 2 cut(s) 474, 893
Tru9I TTAA 2 cut(s) 474, 893
TseFI GTSAC 2 cut(s) 394, 747
Tsp45I GTSAC 2 cut(s) 394, 747
TspDTI ATGAA 3 cut(s) 76, 503, 512
TspGWI ACGGA 5 cut(s) 333, 382, 557, 832, 1046
VpaK11BI GGWCC 1 cut(s) 520
VspI ATTAAT 1 cut(s) 474
XagI CCTNNNNNAGG 1 cut(s) 205
XapI RAATTY 1 cut(s) 1050
XbaI TCTAGA 1 cut(s) 766
XceI RCATGY 1 cut(s) 391
XhoI CTCGAG 1 cut(s) 254
XspI CTAG 2 cut(s) 350, 767
Zsp2I ATGCAT 1 cut(s) 312
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.