pycom12426g00600

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012426
Physical Location & Seq
Forward (+)
461250 .. 461468
219 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12426g00600.1

Sequence Viewer

Length: 219 bp
ATGGTACGGGGTTGCCACTTTGTGGTTGATATTGTACTTCTTCATCAAGGATTCAAAGGGTTTGTTGCAGAAATGGCTGCCACCATCACTAATAATAGCTCTTGGGGTTCCAAACCTACAAAAAATCACATCTTTAAGAAAATTCAACACAACCTTATGATCATTAGTTCTTGTAGCAATGGCTTCAACCCATTTGGATATGTAATCCACTGCCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.06

Weight (kDa)

9.3

Isoelectric Point (pI)

23.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 22
AcsI RAATTY 1 cut(s) 141
AdeI CACNNNGTG 1 cut(s) 22
AfaI GTAC 2 cut(s) 6, 36
AfiI CCNNNNNNNGG 1 cut(s) 22
AgsI TTSAA 3 cut(s) 55, 146, 187
AluBI AGCT 1 cut(s) 99
AluI AGCT 1 cut(s) 99
ApeKI GCWGC 1 cut(s) 77
ApoI RAATTY 1 cut(s) 141
BbvI GCAGC 1 cut(s) 64
BccI CCATC 1 cut(s) 92
BclI TGATCA 1 cut(s) 159
BisI GCNGC 1 cut(s) 78
BlsI GCNGC 1 cut(s) 79
BmiI GGNNCC 1 cut(s) 109
Bsc4I CCNNNNNNNGG 1 cut(s) 22
Bse3DI GCAATG 1 cut(s) 184
BseLI CCNNNNNNNGG 1 cut(s) 22
BseMI GCAATG 1 cut(s) 184
BseXI GCAGC 1 cut(s) 64
BslI CCNNNNNNNGG 1 cut(s) 22
Bsp143I GATC 1 cut(s) 159
BspLI GGNNCC 1 cut(s) 109
BsrDI GCAATG 1 cut(s) 184
BssMI GATC 1 cut(s) 159
BstKTI GATC 1 cut(s) 162
BstMBI GATC 1 cut(s) 159
BstMWI GCNNNNNNNGC 1 cut(s) 74
BstV1I GCAGC 1 cut(s) 64
BtsI GCAGTG 1 cut(s) 208
BtsIMutI CAGTG 1 cut(s) 208
Csp6I GTAC 2 cut(s) 5, 35
CviJI RGCY 3 cut(s) 77, 99, 183
CviKI_1 RGCY 3 cut(s) 77, 99, 183
CviQI GTAC 2 cut(s) 5, 35
DpnI GATC 1 cut(s) 161
DpnII GATC 1 cut(s) 159
DraIII CACNNNGTG 1 cut(s) 22
FaiI YATR 2 cut(s) 158, 201
FbaI TGATCA 1 cut(s) 159
Fnu4HI GCNGC 1 cut(s) 78
Fsp4HI GCNGC 1 cut(s) 78
GluI GCNGC 1 cut(s) 78
HinfI GANTC 1 cut(s) 51
HpyCH4V TGCA 1 cut(s) 68
HpyF10VI GCNNNNNNNGC 1 cut(s) 74
Ksp22I TGATCA 1 cut(s) 159
Kzo9I GATC 1 cut(s) 159
Lsp1109I GCAGC 1 cut(s) 64
MalI GATC 1 cut(s) 161
MboI GATC 1 cut(s) 159
MboII GAAGA 1 cut(s) 32
MluCI AATT 1 cut(s) 141
MseI TTAA 1 cut(s) 135
MwoI GCNNNNNNNGC 1 cut(s) 74
NdeII GATC 1 cut(s) 159
NlaIV GGNNCC 1 cut(s) 109
PfeI GAWTC 1 cut(s) 51
PflMI CCANNNNNTGG 1 cut(s) 22
PkrI GCNGC 1 cut(s) 79
PspN4I GGNNCC 1 cut(s) 109
RsaI GTAC 2 cut(s) 6, 36
RsaNI GTAC 2 cut(s) 5, 35
SaqAI TTAA 1 cut(s) 135
SatI GCNGC 1 cut(s) 78
Sau3AI GATC 1 cut(s) 159
SetI ASST 3 cut(s) 101, 118, 156
SgeI CNNG 4 cut(s) 20, 59, 114, 183
Sse9I AATT 1 cut(s) 141
TasI AATT 1 cut(s) 141
TatI WGTACW 1 cut(s) 34
TfiI GAWTC 1 cut(s) 51
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TscAI CASTG 1 cut(s) 215
TseI GCWGC 1 cut(s) 77
TspDTI ATGAA 1 cut(s) 32
TspRI CASTG 1 cut(s) 215
Van91I CCANNNNNTGG 1 cut(s) 22
XapI RAATTY 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.