pycom17g16590

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0015723
Physical Location & Seq
Forward (+)
14662077 .. 14663659
1583 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g16590.5

Sequence Viewer

Length: 471 bp
ATGGGGGATTGGAATGACAATTTCCCTAGATTCATTGGATTGAATGGATTACGCATTACAACCAAATTATTCCAAATCAAAATCATTAAGTTCAACGGAAATCATAAACATCGACTAGGCATTCATAACTATGGAATACGCATGTTAATCCAGCCTAGGGTGAAATTCCCTTATATCCTAGCATCAAGTTTAGGAATGCAAATTAAGTGTCGACCCTCAACCCACATACATAAACAAGAATTCATAACTGGAGTAAATCAAATCATAACCAACATATGTCCATGGCTTCAAATTTTTGCAAAAATGGGACCCTCCATCACTAATGATCACTCGTGGCATGCCAAACCTTGCAAAAATGTTAGTTCTAATAAAATCTGCAACCACTTTAGAATCATTAGTCCGGGTGGCTTTTGCTTCCACCCACTTCGACACATAATCAACCGCAAGCAAAATATACATAAAACCATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

157

Amino Acids

18.13

Weight (kDa)

10.57

Isoelectric Point (pI)

47.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 211
AciI CCGC 1 cut(s) 442
AcsI RAATTY 3 cut(s) 164, 239, 291
AfiI CCNNNNNNNGG 1 cut(s) 157
AgsI TTSAA 3 cut(s) 43, 94, 290
ApoI RAATTY 3 cut(s) 164, 239, 291
ArsI GACNNNNNNTTYG 2 cut(s) 193, 225
AspA2I CCTAGG 1 cut(s) 155
AspS9I GGNCC 1 cut(s) 308
AsuC2I CCSGG 1 cut(s) 402
AsuHPI GGTGA 1 cut(s) 172
AvaII GGWCC 1 cut(s) 308
AvrII CCTAGG 1 cut(s) 155
BauI CACGAG 1 cut(s) 331
BccI CCATC 1 cut(s) 323
BclI TGATCA 1 cut(s) 325
BcnI CCSGG 1 cut(s) 402
BfaI CTAG 4 cut(s) 27, 116, 156, 179
BlnI CCTAGG 1 cut(s) 155
Bme1390I CCNGG 1 cut(s) 402
Bme18I GGWCC 1 cut(s) 308
BmgT120I GGNCC 1 cut(s) 308
BmiI GGNNCC 2 cut(s) 309, 310
BmrFI CCNGG 1 cut(s) 402
BmsI GCATC 1 cut(s) 191
BpmI CTGGAG 1 cut(s) 270
BpuMI CCSGG 1 cut(s) 402
BsaJI CCNNGG 2 cut(s) 155, 281
Bsc4I CCNNNNNNNGG 1 cut(s) 157
Bse1I ACTGG 1 cut(s) 253
BseDI CCNNGG 2 cut(s) 155, 281
BseLI CCNNNNNNNGG 1 cut(s) 157
BseNI ACTGG 1 cut(s) 253
BsiSI CCGG 1 cut(s) 401
BslFI GGGAC 1 cut(s) 321
BslI CCNNNNNNNGG 1 cut(s) 157
BsmFI GGGAC 1 cut(s) 321
BsmI GAATGC 2 cut(s) 120, 201
Bsp143I GATC 1 cut(s) 325
Bsp19I CCATGG 1 cut(s) 281
BspACI CCGC 1 cut(s) 442
BspLI GGNNCC 2 cut(s) 309, 310
BsrI ACTGG 1 cut(s) 253
BssECI CCNNGG 2 cut(s) 155, 281
BssMI GATC 1 cut(s) 325
BssSI CACGAG 1 cut(s) 331
BssT1I CCWWGG 2 cut(s) 155, 281
Bst2BI CACGAG 1 cut(s) 331
BstC8I GCNNGC 2 cut(s) 339, 446
BstDSI CCRYGG 1 cut(s) 281
BstKTI GATC 1 cut(s) 328
BstMBI GATC 1 cut(s) 325
BstNSI RCATGY 2 cut(s) 145, 341
BstSCI CCNGG 1 cut(s) 400
BtgI CCRYGG 1 cut(s) 281
Cac8I GCNNGC 2 cut(s) 339, 446
Cfr13I GGNCC 1 cut(s) 308
CviAII CATG 4 cut(s) 142, 282, 338, 466
CviJI RGCY 3 cut(s) 154, 286, 408
CviKI_1 RGCY 3 cut(s) 154, 286, 408
DpnI GATC 1 cut(s) 327
DpnII GATC 1 cut(s) 325
Eco130I CCWWGG 2 cut(s) 155, 281
Eco47I GGWCC 1 cut(s) 308
EcoO109I RGGNCCY 1 cut(s) 308
EcoRI GAATTC 1 cut(s) 239
EcoT14I CCWWGG 2 cut(s) 155, 281
ErhI CCWWGG 2 cut(s) 155, 281
FaeI CATG 4 cut(s) 145, 285, 341, 469
FaqI GGGAC 1 cut(s) 321
FatI CATG 4 cut(s) 141, 281, 337, 465
FauNDI CATATG 1 cut(s) 275
FbaI TGATCA 1 cut(s) 325
FblI GTMKAC 1 cut(s) 211
FspBI CTAG 4 cut(s) 27, 116, 156, 179
GsuI CTGGAG 1 cut(s) 270
HapII CCGG 1 cut(s) 401
Hin1II CATG 4 cut(s) 145, 285, 341, 469
HincII GTYRAC 1 cut(s) 212
HindII GTYRAC 1 cut(s) 212
HinfI GANTC 2 cut(s) 30, 390
HpaII CCGG 1 cut(s) 401
HphI GGTGA 1 cut(s) 172
Hpy166II GTNNAC 1 cut(s) 212
Hpy8I GTNNAC 1 cut(s) 212
HpyCH4V TGCA 4 cut(s) 199, 299, 351, 378
Hsp92II CATG 4 cut(s) 145, 285, 341, 469
KflI GGGWCCC 1 cut(s) 308
Ksp22I TGATCA 1 cut(s) 325
Kzo9I GATC 1 cut(s) 325
LpnPI CCDG 3 cut(s) 164, 234, 414
LweI GCATC 1 cut(s) 191
MaeI CTAG 4 cut(s) 27, 116, 156, 179
MalI GATC 1 cut(s) 327
MboI GATC 1 cut(s) 325
MluCI AATT 6 cut(s) 19, 65, 164, 201, 239, 291
MnlI CCTC 2 cut(s) 226, 322
MseI TTAA 3 cut(s) 87, 146, 204
MslI CAYNNNNRTG 1 cut(s) 129
MspI CCGG 1 cut(s) 401
MspR9I CCNGG 1 cut(s) 402
Mva1269I GAATGC 2 cut(s) 120, 201
NciI CCSGG 1 cut(s) 402
NcoI CCATGG 1 cut(s) 281
NdeI CATATG 1 cut(s) 275
NdeII GATC 1 cut(s) 325
NlaIII CATG 4 cut(s) 145, 285, 341, 469
NlaIV GGNNCC 2 cut(s) 309, 310
NspI RCATGY 2 cut(s) 145, 341
PaeI GCATGC 1 cut(s) 341
PctI GAATGC 2 cut(s) 120, 201
PfeI GAWTC 2 cut(s) 30, 390
PpuMI RGGWCCY 1 cut(s) 308
Psp5II RGGWCCY 1 cut(s) 308
PspN4I GGNNCC 2 cut(s) 309, 310
PspPI GGNCC 1 cut(s) 308
PspPPI RGGWCCY 1 cut(s) 308
RseI CAYNNNNRTG 1 cut(s) 129
SalI GTCGAC 1 cut(s) 210
SaqAI TTAA 3 cut(s) 87, 146, 204
Sau3AI GATC 1 cut(s) 325
Sau96I GGNCC 1 cut(s) 308
ScrFI CCNGG 1 cut(s) 402
SetI ASST 1 cut(s) 349
SfaNI GCATC 1 cut(s) 191
SinI GGWCC 1 cut(s) 308
SmiMI CAYNNNNRTG 1 cut(s) 129
SphI GCATGC 1 cut(s) 341
Sse9I AATT 6 cut(s) 19, 65, 164, 201, 239, 291
SsiI CCGC 1 cut(s) 442
SspMI CTAG 4 cut(s) 27, 116, 156, 179
StyD4I CCNGG 1 cut(s) 400
StyI CCWWGG 2 cut(s) 155, 281
TaqI TCGA 3 cut(s) 112, 211, 427
TasI AATT 6 cut(s) 19, 65, 164, 201, 239, 291
TfiI GAWTC 2 cut(s) 30, 390
Tru1I TTAA 3 cut(s) 87, 146, 204
Tru9I TTAA 3 cut(s) 87, 146, 204
TspDTI ATGAA 3 cut(s) 22, 113, 232
TspGWI ACGGA 1 cut(s) 111
VpaK11BI GGWCC 1 cut(s) 308
XapI RAATTY 3 cut(s) 164, 239, 291
XceI RCATGY 2 cut(s) 145, 341
XmaJI CCTAGG 1 cut(s) 155
XmiI GTMKAC 1 cut(s) 211
XspI CTAG 4 cut(s) 27, 116, 156, 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.