pycom12g19840

50S ribosomal protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
OG0009364
Physical Location & Seq
Reverse (-)
21534733 .. 21535011
279 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 279 bp
ATGCACTTCACAAACAAATACGTAAGCGCCCAGGTGATCCACACACCAACTGCCACAGTGGCATCTTCTGCAAGCTCCCAAGAAAAGGCCTTGAGAGAAATCATGGAGATACGTCGTGATGTTGCTGCTGCTGCAAAGATTGGGAAGATATTAGGGGAGCGCCTGCTGCTCAAGAACATTCCCGCTGTATCTGTCCACTTGAAGAAGGAACAGAAATATCACGGTAAAGTTAAAGCTGTCATTGATAGTGTGGTTGAAGCAGGTGTCAAACTACTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ribosomal_L18p

Protein Analysis

93

Amino Acids

10.03

Weight (kDa)

9.93

Isoelectric Point (pI)

40.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L18p PF00861 4 - 91 3.2e-13 Ribosomal L18 of archaea, bacteria, mitoch. and chloroplast
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 251
Acc36I ACCTGC 1 cut(s) 251
AciI CCGC 1 cut(s) 183
AclWI GGATC 1 cut(s) 31
AfiI CCNNNNNNNGG 1 cut(s) 85
AgsI TTSAA 2 cut(s) 202, 257
AjnI CCWGG 1 cut(s) 30
AluBI AGCT 2 cut(s) 75, 236
AluI AGCT 2 cut(s) 75, 236
AlwI GGATC 1 cut(s) 31
AoxI GGCC 1 cut(s) 87
ApeKI GCWGC 4 cut(s) 125, 128, 131, 166
AspLEI GCGC 2 cut(s) 29, 162
AsuHPI GGTGA 1 cut(s) 46
BbvI GCAGC 4 cut(s) 112, 115, 118, 153
BciT130I CCWGG 1 cut(s) 32
BfoI RGCGCY 2 cut(s) 30, 163
BfuAI ACCTGC 1 cut(s) 251
BglI GCCNNNNNGGC 1 cut(s) 59
BisI GCNGC 4 cut(s) 126, 129, 132, 167
BlsI GCNGC 4 cut(s) 127, 130, 133, 168
Bme1390I CCNGG 1 cut(s) 32
BmrFI CCNGG 1 cut(s) 32
BmsI GCATC 1 cut(s) 71
BpuEI CTTGAG 2 cut(s) 112, 155
BsaAI YACGTR 1 cut(s) 22
BsaJI CCNNGG 1 cut(s) 30
Bsc4I CCNNNNNNNGG 1 cut(s) 85
BseBI CCWGG 1 cut(s) 32
BseDI CCNNGG 1 cut(s) 30
BseLI CCNNNNNNNGG 1 cut(s) 85
BseXI GCAGC 4 cut(s) 112, 115, 118, 153
BshFI GGCC 1 cut(s) 89
BslI CCNNNNNNNGG 1 cut(s) 85
BsnI GGCC 1 cut(s) 89
Bsp143I GATC 1 cut(s) 36
BspACI CCGC 1 cut(s) 183
BspANI GGCC 1 cut(s) 89
BspMI ACCTGC 1 cut(s) 251
BspPI GGATC 1 cut(s) 31
BssECI CCNNGG 1 cut(s) 30
BssMI GATC 1 cut(s) 36
Bst2UI CCWGG 1 cut(s) 32
Bst4CI ACNGT 2 cut(s) 58, 224
BstAPI GCANNNNNTGC 1 cut(s) 68
BstBAI YACGTR 1 cut(s) 22
BstC8I GCNNGC 2 cut(s) 73, 164
BstH2I RGCGCY 2 cut(s) 30, 163
BstHHI GCGC 2 cut(s) 29, 162
BstKTI GATC 1 cut(s) 39
BstMBI GATC 1 cut(s) 36
BstMWI GCNNNNNNNGC 4 cut(s) 59, 68, 131, 166
BstNI CCWGG 1 cut(s) 32
BstSCI CCNGG 1 cut(s) 30
BstSNI TACGTA 1 cut(s) 22
BstV1I GCAGC 4 cut(s) 112, 115, 118, 153
BsuRI GGCC 1 cut(s) 89
BtsIMutI CAGTG 1 cut(s) 63
BveI ACCTGC 1 cut(s) 251
Cac8I GCNNGC 2 cut(s) 73, 164
CfoI GCGC 2 cut(s) 29, 162
CviAII CATG 1 cut(s) 103
CviJI RGCY 3 cut(s) 75, 89, 236
CviKI_1 RGCY 3 cut(s) 75, 89, 236
DpnI GATC 1 cut(s) 38
DpnII GATC 1 cut(s) 36
Eco105I TACGTA 1 cut(s) 22
Eco147I AGGCCT 1 cut(s) 89
EcoRII CCWGG 1 cut(s) 30
FaeI CATG 1 cut(s) 106
FaiI YATR 1 cut(s) 104
FatI CATG 1 cut(s) 102
FauI CCCGC 1 cut(s) 190
Fnu4HI GCNGC 4 cut(s) 126, 129, 132, 167
Fsp4HI GCNGC 4 cut(s) 126, 129, 132, 167
GlaI GCGC 2 cut(s) 28, 161
GluI GCNGC 4 cut(s) 126, 129, 132, 167
HaeII RGCGCY 2 cut(s) 30, 163
HaeIII GGCC 1 cut(s) 89
HhaI GCGC 2 cut(s) 29, 162
Hin1II CATG 1 cut(s) 106
Hin6I GCGC 2 cut(s) 27, 160
HinP1I GCGC 2 cut(s) 27, 160
HphI GGTGA 1 cut(s) 46
Hpy166II GTNNAC 1 cut(s) 196
Hpy188I TCNGA 1 cut(s) 278
Hpy188III TCNNGA 2 cut(s) 116, 172
Hpy8I GTNNAC 1 cut(s) 196
Hpy99I CGWCG 1 cut(s) 117
HpyAV CCTTC 1 cut(s) 199
HpyCH4III ACNGT 2 cut(s) 58, 224
HpyCH4IV ACGT 2 cut(s) 21, 112
HpyCH4V TGCA 3 cut(s) 4, 71, 134
HpyF10VI GCNNNNNNNGC 4 cut(s) 59, 68, 131, 166
HpySE526I ACGT 2 cut(s) 21, 112
Hsp92II CATG 1 cut(s) 106
HspAI GCGC 2 cut(s) 27, 160
Kzo9I GATC 1 cut(s) 36
LmnI GCTCC 2 cut(s) 80, 157
LpnPI CCDG 4 cut(s) 17, 44, 176, 246
Lsp1109I GCAGC 4 cut(s) 112, 115, 118, 153
LweI GCATC 1 cut(s) 71
MaeII ACGT 2 cut(s) 21, 112
MalI GATC 1 cut(s) 38
MboI GATC 1 cut(s) 36
MboII GAAGA 3 cut(s) 57, 157, 214
MseI TTAA 1 cut(s) 231
MspA1I CMGCKG 1 cut(s) 185
MspR9I CCNGG 1 cut(s) 32
MvaI CCWGG 1 cut(s) 32
MwoI GCNNNNNNNGC 4 cut(s) 59, 68, 131, 166
NdeII GATC 1 cut(s) 36
NlaIII CATG 1 cut(s) 106
PaqCI CACCTGC 1 cut(s) 251
PceI AGGCCT 1 cut(s) 89
PkrI GCNGC 4 cut(s) 127, 130, 133, 168
Ppu21I YACGTR 1 cut(s) 22
Psp6I CCWGG 1 cut(s) 30
PspGI CCWGG 1 cut(s) 30
SaqAI TTAA 1 cut(s) 231
SatI GCNGC 4 cut(s) 126, 129, 132, 167
Sau3AI GATC 1 cut(s) 36
ScrFI CCNGG 1 cut(s) 32
SetI ASST 6 cut(s) 24, 36, 77, 115, 238, 265
SfaNI GCATC 1 cut(s) 71
SmlI CTYRAG 2 cut(s) 91, 170
SmoI CTYRAG 2 cut(s) 91, 170
SnaBI TACGTA 1 cut(s) 22
SseBI AGGCCT 1 cut(s) 89
SsiI CCGC 1 cut(s) 183
StuI AGGCCT 1 cut(s) 89
StyD4I CCNGG 1 cut(s) 30
TaaI ACNGT 2 cut(s) 58, 224
TaiI ACGT 2 cut(s) 24, 115
Tru1I TTAA 1 cut(s) 231
Tru9I TTAA 1 cut(s) 231
TscAI CASTG 1 cut(s) 63
TseI GCWGC 4 cut(s) 125, 128, 131, 166
TspRI CASTG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.