pycom13g01230

Sodium hydrogen exchanger

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Reverse (-)
792920 .. 793237
318 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g01230.2

Sequence Viewer

Length: 246 bp
ATGTGTTTAATTTCATCCAGGACAGCAATTGTAGTGTATCAGATATTTTATCAGATGGTCCTTGGAAAGAGCTATGACTGGACCGCCATAATTAAATTTCTATCTCAAGTCACATTTGGAGCTGTAGGCATTGGTCTTGCTTTTGGCATAGTATCTATACTTTGGCTTGGGTTTATTTTCAATGACACCGTGATAGAGATCACACTAACACTTGCGGTCAGCTATGTTGCTTACTTCACTGTATGA

Protein Analysis

82

Amino Acids

9.01

Weight (kDa)

5.87

Isoelectric Point (pI)

27.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 84, 215
AcsI RAATTY 1 cut(s) 95
AgsI TTSAA 1 cut(s) 181
AjnI CCWGG 1 cut(s) 17
AluBI AGCT 3 cut(s) 72, 122, 222
AluI AGCT 3 cut(s) 72, 122, 222
ApoI RAATTY 1 cut(s) 95
AspS9I GGNCC 2 cut(s) 58, 81
AvaII GGWCC 2 cut(s) 58, 81
BccI CCATC 1 cut(s) 49
BciT130I CCWGG 1 cut(s) 19
BfmI CTRYAG 1 cut(s) 123
Bme1390I CCNGG 1 cut(s) 19
Bme18I GGWCC 2 cut(s) 58, 81
BmgT120I GGNCC 2 cut(s) 58, 81
BmrFI CCNGG 1 cut(s) 19
BpuEI CTTGAG 1 cut(s) 90
BsaBI GATNNNNATC 1 cut(s) 197
BsaJI CCNNGG 1 cut(s) 61
Bse1I ACTGG 1 cut(s) 83
Bse8I GATNNNNATC 1 cut(s) 197
BseBI CCWGG 1 cut(s) 19
BseDI CCNNGG 1 cut(s) 61
BseGI GGATG 1 cut(s) 14
BseJI GATNNNNATC 1 cut(s) 197
BseNI ACTGG 1 cut(s) 83
Bsp143I GATC 1 cut(s) 198
BspACI CCGC 2 cut(s) 84, 215
BsrI ACTGG 1 cut(s) 83
BssECI CCNNGG 1 cut(s) 61
BssMI GATC 1 cut(s) 198
BssT1I CCWWGG 1 cut(s) 61
Bst2UI CCWGG 1 cut(s) 19
Bst4CI ACNGT 2 cut(s) 190, 241
BstF5I GGATG 1 cut(s) 14
BstKTI GATC 1 cut(s) 201
BstMBI GATC 1 cut(s) 198
BstNI CCWGG 1 cut(s) 19
BstSCI CCNGG 1 cut(s) 17
BstSFI CTRYAG 1 cut(s) 123
BtsCI GGATG 1 cut(s) 14
BtsIMutI CAGTG 1 cut(s) 237
Cfr13I GGNCC 2 cut(s) 58, 81
CviJI RGCY 4 cut(s) 72, 122, 166, 222
CviKI_1 RGCY 4 cut(s) 72, 122, 166, 222
DpnI GATC 1 cut(s) 200
DpnII GATC 1 cut(s) 198
Eco130I CCWWGG 1 cut(s) 61
Eco47I GGWCC 2 cut(s) 58, 81
EcoRII CCWGG 1 cut(s) 17
EcoT14I CCWWGG 1 cut(s) 61
ErhI CCWWGG 1 cut(s) 61
FaiI YATR 6 cut(s) 75, 89, 149, 158, 225, 244
Hpy188I TCNGA 2 cut(s) 42, 54
HpyCH4III ACNGT 2 cut(s) 190, 241
Kzo9I GATC 1 cut(s) 198
LmnI GCTCC 1 cut(s) 119
LpnPI CCDG 3 cut(s) 4, 31, 64
MaeIII GTNAC 1 cut(s) 109
MalI GATC 1 cut(s) 200
MboI GATC 1 cut(s) 198
MfeI CAATTG 1 cut(s) 27
MluCI AATT 4 cut(s) 9, 27, 90, 95
MseI TTAA 2 cut(s) 8, 93
MspR9I CCNGG 1 cut(s) 19
MunI CAATTG 1 cut(s) 27
MvaI CCWGG 1 cut(s) 19
NdeII GATC 1 cut(s) 198
NmuCI GTSAC 1 cut(s) 109
PfoI TCCNGGA 1 cut(s) 17
Psp6I CCWGG 1 cut(s) 17
PspGI CCWGG 1 cut(s) 17
PspPI GGNCC 2 cut(s) 58, 81
SaqAI TTAA 2 cut(s) 8, 93
Sau3AI GATC 1 cut(s) 198
Sau96I GGNCC 2 cut(s) 58, 81
ScrFI CCNGG 1 cut(s) 19
SetI ASST 3 cut(s) 74, 124, 224
SfcI CTRYAG 1 cut(s) 123
SgeI CNNG 9 cut(s) 30, 31, 74, 91, 119, 149, 179, 202, 224
SinI GGWCC 2 cut(s) 58, 81
SmlI CTYRAG 1 cut(s) 105
SmoI CTYRAG 1 cut(s) 105
Sse9I AATT 4 cut(s) 9, 27, 90, 95
SsiI CCGC 2 cut(s) 84, 215
StyD4I CCNGG 1 cut(s) 17
StyI CCWWGG 1 cut(s) 61
TaaI ACNGT 2 cut(s) 190, 241
TasI AATT 4 cut(s) 9, 27, 90, 95
Tru1I TTAA 2 cut(s) 8, 93
Tru9I TTAA 2 cut(s) 8, 93
TscAI CASTG 1 cut(s) 244
TseFI GTSAC 1 cut(s) 109
Tsp45I GTSAC 1 cut(s) 109
TspRI CASTG 1 cut(s) 244
VpaK11BI GGWCC 2 cut(s) 58, 81
XapI RAATTY 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.