pycom13g20010

7-hydroxymethyl chlorophyll a reductase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Reverse (-)
15988520 .. 15989161
642 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g20010.2

Sequence Viewer

Length: 303 bp
ATGATACTGCTAAGATGGGTATGTGCAGCAGCTTCTTTGAGATACTTTAGAAAAGGTCCTGAGCCTGCACCAAAGTTTGTCGGCAATGTGATCGCTTTCTTGTTAAACTTGATTGGCCCAAAAGGTTTGGAATTTGCTCGTTATTCGCTCGATTACCATACCATCCGGAACTACCTATATGTAAACCGAACATGGGGAAAACAAAGAGCTGATCAGCATATGCCTTCATATGCAAAGAAGATTGTCGATTCCTACAACAAGAATGGTGAAATCGATCGGATTCTTTCCACCAAGCCCAAGTGA

Protein Analysis

101

Amino Acids

11.6

Weight (kDa)

10.0

Isoelectric Point (pI)

32.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 165
AcsI RAATTY 1 cut(s) 131
AfiI CCNNNNNNNGG 1 cut(s) 193
AluBI AGCT 2 cut(s) 32, 209
AluI AGCT 2 cut(s) 32, 209
Aor13HI TCCGGA 1 cut(s) 165
AoxI GGCC 1 cut(s) 115
ApeKI GCWGC 2 cut(s) 26, 29
ApoI RAATTY 1 cut(s) 131
AspS9I GGNCC 2 cut(s) 56, 116
AsuHPI GGTGA 1 cut(s) 278
AvaII GGWCC 1 cut(s) 56
BbvI GCAGC 2 cut(s) 38, 41
BccI CCATC 2 cut(s) 9, 170
BcgI CGANNNNNNTGC 2 cut(s) 73, 107
BclI TGATCA 1 cut(s) 211
BisI GCNGC 2 cut(s) 27, 30
BlsI GCNGC 2 cut(s) 28, 31
Bme18I GGWCC 1 cut(s) 56
BmgT120I GGNCC 2 cut(s) 56, 116
Bpu10I CCTNAGC 1 cut(s) 60
Bsa29I ATCGAT 1 cut(s) 273
BsaWI WCCGGW 1 cut(s) 165
Bsc4I CCNNNNNNNGG 1 cut(s) 193
Bse3DI GCAATG 1 cut(s) 91
BseAI TCCGGA 1 cut(s) 165
BseCI ATCGAT 1 cut(s) 273
BseGI GGATG 1 cut(s) 162
BseLI CCNNNNNNNGG 1 cut(s) 193
BseMI GCAATG 1 cut(s) 91
BseMII CTCAG 1 cut(s) 51
BseXI GCAGC 2 cut(s) 38, 41
BsgI GTGCAG 2 cut(s) 45, 51
Bsh1285I CGRYCG 1 cut(s) 277
BshFI GGCC 1 cut(s) 117
BshVI ATCGAT 1 cut(s) 273
BsiEI CGRYCG 1 cut(s) 277
BsiSI CCGG 1 cut(s) 166
BslI CCNNNNNNNGG 1 cut(s) 193
BsnI GGCC 1 cut(s) 117
Bsp13I TCCGGA 1 cut(s) 165
Bsp143I GATC 3 cut(s) 90, 211, 274
BspANI GGCC 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 52
BspDI ATCGAT 1 cut(s) 273
BspEI TCCGGA 1 cut(s) 165
BsrDI GCAATG 1 cut(s) 91
BssMI GATC 3 cut(s) 90, 211, 274
BstC8I GCNNGC 1 cut(s) 66
BstDEI CTNAG 2 cut(s) 11, 60
BstF5I GGATG 1 cut(s) 162
BstKTI GATC 3 cut(s) 93, 214, 277
BstMBI GATC 3 cut(s) 90, 211, 274
BstMCI CGRYCG 1 cut(s) 277
BstV1I GCAGC 2 cut(s) 38, 41
Bsu15I ATCGAT 1 cut(s) 273
BsuRI GGCC 1 cut(s) 117
BsuTUI ATCGAT 1 cut(s) 273
BtsCI GGATG 1 cut(s) 162
Cac8I GCNNGC 1 cut(s) 66
Cfr13I GGNCC 2 cut(s) 56, 116
ClaI ATCGAT 1 cut(s) 273
CviAII CATG 1 cut(s) 192
CviJI RGCY 5 cut(s) 32, 64, 117, 209, 295
CviKI_1 RGCY 5 cut(s) 32, 64, 117, 209, 295
DdeI CTNAG 2 cut(s) 11, 60
DpnI GATC 3 cut(s) 92, 213, 276
DpnII GATC 3 cut(s) 90, 211, 274
Eco47I GGWCC 1 cut(s) 56
EcoO109I RGGNCCY 1 cut(s) 56
FaeI CATG 1 cut(s) 195
FaiI YATR 9 cut(s) 22, 159, 178, 180, 193, 219, 221, 229, 231
FatI CATG 1 cut(s) 191
FauNDI CATATG 2 cut(s) 219, 229
FbaI TGATCA 1 cut(s) 211
Fnu4HI GCNGC 2 cut(s) 27, 30
FokI GGATG 1 cut(s) 149
Fsp4HI GCNGC 2 cut(s) 27, 30
GluI GCNGC 2 cut(s) 27, 30
HaeIII GGCC 1 cut(s) 117
HapII CCGG 1 cut(s) 166
Hin1II CATG 1 cut(s) 195
HinfI GANTC 2 cut(s) 248, 280
HpaII CCGG 1 cut(s) 166
HphI GGTGA 1 cut(s) 278
Hpy166II GTNNAC 1 cut(s) 184
Hpy188I TCNGA 1 cut(s) 279
Hpy188III TCNNGA 2 cut(s) 59, 166
Hpy8I GTNNAC 1 cut(s) 184
HpyAV CCTTC 1 cut(s) 234
HpyCH4V TGCA 3 cut(s) 26, 68, 233
HpyF3I CTNAG 2 cut(s) 11, 60
Hsp92II CATG 1 cut(s) 195
Kpn2I TCCGGA 1 cut(s) 165
Ksp22I TGATCA 1 cut(s) 211
Kzo9I GATC 3 cut(s) 90, 211, 274
LpnPI CCDG 3 cut(s) 72, 78, 179
Lsp1109I GCAGC 2 cut(s) 38, 41
MalI GATC 3 cut(s) 92, 213, 276
MboI GATC 3 cut(s) 90, 211, 274
MboII GAAGA 1 cut(s) 250
MluCI AATT 1 cut(s) 131
MroI TCCGGA 1 cut(s) 165
MseI TTAA 1 cut(s) 104
MspI CCGG 1 cut(s) 166
NdeI CATATG 2 cut(s) 219, 229
NdeII GATC 3 cut(s) 90, 211, 274
NlaIII CATG 1 cut(s) 195
PfeI GAWTC 2 cut(s) 248, 280
PkrI GCNGC 2 cut(s) 28, 31
Ple19I CGATCG 1 cut(s) 277
PpuMI RGGWCCY 1 cut(s) 56
Psp5II RGGWCCY 1 cut(s) 56
PspPI GGNCC 2 cut(s) 56, 116
PspPPI RGGWCCY 1 cut(s) 56
PvuI CGATCG 1 cut(s) 277
SaqAI TTAA 1 cut(s) 104
SatI GCNGC 2 cut(s) 27, 30
Sau3AI GATC 3 cut(s) 90, 211, 274
Sau96I GGNCC 2 cut(s) 56, 116
SetI ASST 5 cut(s) 34, 58, 127, 177, 211
SgeI CNNG 9 cut(s) 71, 77, 112, 121, 150, 161, 178, 204, 271
SinI GGWCC 1 cut(s) 56
Sse9I AATT 1 cut(s) 131
TaqI TCGA 3 cut(s) 150, 246, 273
TasI AATT 1 cut(s) 131
TfiI GAWTC 2 cut(s) 248, 280
Tru1I TTAA 1 cut(s) 104
Tru9I TTAA 1 cut(s) 104
TseI GCWGC 2 cut(s) 26, 29
TspDTI ATGAA 1 cut(s) 216
VpaK11BI GGWCC 1 cut(s) 56
XapI RAATTY 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.