pycom15g10030

RNA methyltransferase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
6555853 .. 6556491
639 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 291 bp
ATGGACCTTATAAGGTCCGATGATTGGGTGGTGCTGTTGGATGAGCGTGGGAAAGACATAGGGTCGGAGCGGATGGCAGAGTTGGTGGGGGATGCAGGGAATACAGGAGCTTCAAGACTATCCTTCTGCGTCGGTGGACCTTACGGCCATGGAAAACAATTGCGAGAACGTGCTGATGTTTGTATCAAGTTGTCTTCTATGGTTTTAAACCATCAAATTGCATTAGTTGTTCTTGTGGAACAACTTTATAGGTCATGGACTATTCTGAAAGGACAGAACTATCATCGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.76

Weight (kDa)

6.82

Isoelectric Point (pI)

18.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SPOUT_MTase PF02590 4 - 95 5.1e-33 Predicted SPOUT methyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015123)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G10620 AT5G10620
fragaria_vesca FvH4_2g30670
malus_domestica MD15G1110100.v1.1
prunus_persica Prupe.1G462300_v2.0.a1
pyrus_communis pycom15g10030
rosa_chinensis RchiOBHm_Chr6g0312221
rosa_laevigata RLG00000010341
rosa_multiflora Rmu_sc0010924.1_g000004
rosa_roxburghii Rroxscaffold_7G00156940
rosa_rugosa Rorug06G0394200
rosa_samantha Rh6AG511100 Rh6BG522100 Rh6CG527900 Rh6DG513300
rosa_wichuraiana Rw6G044450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 11
AccBSI CCGCTC 1 cut(s) 70
AciI CCGC 1 cut(s) 70
AcoI YGGCCR 1 cut(s) 145
AfiI CCNNNNNNNGG 1 cut(s) 24
AgsI TTSAA 1 cut(s) 114
AhdI GACNNNNNGTC 1 cut(s) 61
AluBI AGCT 1 cut(s) 110
AluI AGCT 1 cut(s) 110
AoxI GGCC 1 cut(s) 145
AspS9I GGNCC 3 cut(s) 4, 15, 137
AvaII GGWCC 3 cut(s) 4, 15, 137
BbsI GAAGAC 1 cut(s) 186
BccI CCATC 2 cut(s) 67, 219
BceAI ACGGC 1 cut(s) 160
Bme18I GGWCC 3 cut(s) 4, 15, 137
BmeRI GACNNNNNGTC 1 cut(s) 61
BmgT120I GGNCC 3 cut(s) 4, 15, 137
BmsI GCATC 1 cut(s) 82
BpiI GAAGAC 1 cut(s) 186
BsaJI CCNNGG 1 cut(s) 148
Bsc4I CCNNNNNNNGG 1 cut(s) 24
BseDI CCNNGG 1 cut(s) 148
BseGI GGATG 3 cut(s) 46, 78, 97
BseLI CCNNNNNNNGG 1 cut(s) 24
BshFI GGCC 1 cut(s) 147
BslI CCNNNNNNNGG 1 cut(s) 24
BsnI GGCC 1 cut(s) 147
Bsp19I CCATGG 1 cut(s) 148
BspACI CCGC 1 cut(s) 70
BspANI GGCC 1 cut(s) 147
BsrBI CCGCTC 1 cut(s) 70
BssECI CCNNGG 1 cut(s) 148
BssT1I CCWWGG 1 cut(s) 148
BstDSI CCRYGG 1 cut(s) 148
BstF5I GGATG 3 cut(s) 46, 78, 97
BstV2I GAAGAC 1 cut(s) 186
BsuRI GGCC 1 cut(s) 147
BtgI CCRYGG 1 cut(s) 148
BtsCI GGATG 3 cut(s) 46, 78, 97
Cfr13I GGNCC 3 cut(s) 4, 15, 137
CseI GACGC 1 cut(s) 118
CviAII CATG 2 cut(s) 149, 255
CviJI RGCY 2 cut(s) 110, 147
CviKI_1 RGCY 2 cut(s) 110, 147
DraI TTTAAA 1 cut(s) 207
DriI GACNNNNNGTC 1 cut(s) 61
EaeI YGGCCR 1 cut(s) 145
Eam1105I GACNNNNNGTC 1 cut(s) 61
Eco130I CCWWGG 1 cut(s) 148
Eco47I GGWCC 3 cut(s) 4, 15, 137
EcoT14I CCWWGG 1 cut(s) 148
ErhI CCWWGG 1 cut(s) 148
FaeI CATG 2 cut(s) 152, 258
FaiI YATR 6 cut(s) 11, 59, 150, 200, 249, 256
FatI CATG 2 cut(s) 148, 254
FokI GGATG 3 cut(s) 53, 85, 104
HaeIII GGCC 1 cut(s) 147
HgaI GACGC 1 cut(s) 118
Hin1II CATG 2 cut(s) 152, 258
Hpy166II GTNNAC 1 cut(s) 137
Hpy188I TCNGA 3 cut(s) 19, 67, 267
Hpy188III TCNNGA 1 cut(s) 114
Hpy8I GTNNAC 1 cut(s) 137
Hpy99I CGWCG 1 cut(s) 134
HpyAV CCTTC 1 cut(s) 133
HpyCH4IV ACGT 1 cut(s) 169
HpyCH4V TGCA 2 cut(s) 95, 221
HpySE526I ACGT 1 cut(s) 169
Hsp92II CATG 2 cut(s) 152, 258
LmnI GCTCC 2 cut(s) 67, 107
LpnPI CCDG 2 cut(s) 81, 90
LweI GCATC 1 cut(s) 82
MaeII ACGT 1 cut(s) 169
MbiI CCGCTC 1 cut(s) 70
MboII GAAGA 1 cut(s) 186
MfeI CAATTG 1 cut(s) 158
MluCI AATT 2 cut(s) 158, 216
MmeI TCCRAC 2 cut(s) 18, 45
MseI TTAA 1 cut(s) 206
MunI CAATTG 1 cut(s) 158
NcoI CCATGG 1 cut(s) 148
NlaIII CATG 2 cut(s) 152, 258
PsiI TTATAA 1 cut(s) 11
PspPI GGNCC 3 cut(s) 4, 15, 137
SaqAI TTAA 1 cut(s) 206
Sau96I GGNCC 3 cut(s) 4, 15, 137
SetI ASST 6 cut(s) 9, 17, 112, 142, 172, 254
SfaNI GCATC 1 cut(s) 82
SinI GGWCC 3 cut(s) 4, 15, 137
Sse9I AATT 2 cut(s) 158, 216
SsiI CCGC 1 cut(s) 70
StyI CCWWGG 1 cut(s) 148
TaiI ACGT 1 cut(s) 172
TasI AATT 2 cut(s) 158, 216
Tru1I TTAA 1 cut(s) 206
Tru9I TTAA 1 cut(s) 206
VpaK11BI GGWCC 3 cut(s) 4, 15, 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.