Rmu_sc0010924.1_g000004

RNA methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010924.1
Physical Location & Seq
Reverse (-)
10463 .. 12066
1604 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010924.1_g000004.1.cds

Sequence Viewer

Length: 558 bp
atggttgtggtgcttagtgcctctgctaccaatttctctgcacttccttcaggtaaaggttgcaagtacacaggtcaagcagtgagagcacttcctatacgcataatatcggtggggaaaaagagatcacaaggtgtacaactcgttgtggatgactacattcaaaggcttaagttatactgtagcgttgaggatgttcacataaagaacaatcctaagaatgcaagtgattggagggctcaggtagatcatgaagacagtgctgtcatggatcttatcaggtccgatgattgggtggtgctgttggatgagcgtgggaaagacataggttccatgcagatggctgagctgatcggagatgcagggaatacgggagcttcaagactatcattctgtgttggtggaccttatggacatggaaaacaattgcgagagcgagctaacatatctatcaagttgtcttctatggtattgaatcatcaaattgctatacttgtgctcgtagaacaactatataggtcatggaccattctgaagggtcagaactatcatcgctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

185

Amino Acids

20.48

Weight (kDa)

9.17

Isoelectric Point (pI)

22.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015123)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G10620 AT5G10620
fragaria_vesca FvH4_2g30670
malus_domestica MD15G1110100.v1.1
prunus_persica Prupe.1G462300_v2.0.a1
pyrus_communis pycom15g10030
rosa_chinensis RchiOBHm_Chr6g0312221
rosa_laevigata RLG00000010341
rosa_multiflora Rmu_sc0010924.1_g000004
rosa_roxburghii Rroxscaffold_7G00156940
rosa_rugosa Rorug06G0394200
rosa_samantha Rh6AG511100 Rh6BG522100 Rh6CG527900 Rh6DG513300
rosa_wichuraiana Rw6G044450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 263
AclWI GGATC 1 cut(s) 279
AcuI CTGAAG 2 cut(s) 33, 554
AdeI CACNNNGTG 1 cut(s) 134
AfaI GTAC 2 cut(s) 68, 138
AfiI CCNNNNNNNGG 1 cut(s) 291
AflII CTTAAG 1 cut(s) 170
AgsI TTSAA 3 cut(s) 164, 381, 475
AluBI AGCT 3 cut(s) 349, 377, 440
AluI AGCT 3 cut(s) 349, 377, 440
Alw21I GWGCWC 2 cut(s) 91, 501
AlwI GGATC 1 cut(s) 279
AspS9I GGNCC 3 cut(s) 282, 404, 525
AvaII GGWCC 3 cut(s) 282, 404, 525
BanII GRGCYC 1 cut(s) 241
BbsI GAAGAC 2 cut(s) 261, 453
Bbv12I GWGCWC 2 cut(s) 91, 501
BccI CCATC 1 cut(s) 334
BfaI CTAG 1 cut(s) 556
BfmI CTRYAG 1 cut(s) 181
BfrI CTTAAG 1 cut(s) 170
BlpI GCTNAGC 1 cut(s) 345
Bme18I GGWCC 3 cut(s) 282, 404, 525
BmgT120I GGNCC 3 cut(s) 282, 404, 525
BmiI GGNNCC 1 cut(s) 331
BmsI GCATC 1 cut(s) 349
BpiI GAAGAC 2 cut(s) 261, 453
Bpu10I CCTNAGC 1 cut(s) 240
Bpu1102I GCTNAGC 1 cut(s) 345
Bsc4I CCNNNNNNNGG 1 cut(s) 291
BseGI GGATG 3 cut(s) 157, 199, 313
BseLI CCNNNNNNNGG 1 cut(s) 291
BseMII CTCAG 2 cut(s) 254, 336
BsgI GTGCAG 1 cut(s) 24
BsiHKAI GWGCWC 2 cut(s) 91, 501
BslI CCNNNNNNNGG 1 cut(s) 291
BsmI GAATGC 1 cut(s) 226
Bsp1286I GDGCHC 3 cut(s) 91, 241, 501
Bsp1407I TGTACA 1 cut(s) 136
Bsp143I GATC 4 cut(s) 125, 247, 271, 351
Bsp1720I GCTNAGC 1 cut(s) 345
BspCNI CTCAG 2 cut(s) 253, 337
BspHI TCATGA 1 cut(s) 250
BspLI GGNNCC 1 cut(s) 331
BspPI GGATC 1 cut(s) 279
BspTI CTTAAG 1 cut(s) 170
BsrGI TGTACA 1 cut(s) 136
BssMI GATC 4 cut(s) 125, 247, 271, 351
Bst4CI ACNGT 2 cut(s) 182, 260
BstAFI CTTAAG 1 cut(s) 170
BstAUI TGTACA 1 cut(s) 136
BstC8I GCNNGC 1 cut(s) 438
BstDEI CTNAG 4 cut(s) 14, 216, 240, 345
BstF5I GGATG 3 cut(s) 157, 199, 313
BstKTI GATC 4 cut(s) 128, 250, 274, 354
BstMBI GATC 4 cut(s) 125, 247, 271, 351
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstSFI CTRYAG 1 cut(s) 181
BstV2I GAAGAC 2 cut(s) 261, 453
BstX2I RGATCY 1 cut(s) 271
BstXI CCANNNNNNTGG 1 cut(s) 340
BstYI RGATCY 1 cut(s) 271
BtgZI GCGATG 1 cut(s) 536
BtsCI GGATG 3 cut(s) 157, 199, 313
BtsI GCAGTG 1 cut(s) 87
BtsIMutI CAGTG 2 cut(s) 87, 265
Cac8I GCNNGC 1 cut(s) 438
CciI TCATGA 1 cut(s) 250
Cfr13I GGNCC 3 cut(s) 282, 404, 525
Csp6I GTAC 2 cut(s) 67, 137
CviAII CATG 5 cut(s) 251, 268, 334, 416, 522
CviJI RGCY 6 cut(s) 169, 239, 344, 349, 377, 440
CviKI_1 RGCY 6 cut(s) 169, 239, 344, 349, 377, 440
CviQI GTAC 2 cut(s) 67, 137
DdeI CTNAG 4 cut(s) 14, 216, 240, 345
DpnI GATC 4 cut(s) 127, 249, 273, 353
DpnII GATC 4 cut(s) 125, 247, 271, 351
DraIII CACNNNGTG 1 cut(s) 134
DrdI GACNNNNNNGTC 1 cut(s) 263
DseDI GACNNNNNNGTC 1 cut(s) 263
Eco24I GRGCYC 1 cut(s) 241
Eco47I GGWCC 3 cut(s) 282, 404, 525
Eco57I CTGAAG 2 cut(s) 33, 554
EcoT38I GRGCYC 1 cut(s) 241
FaeI CATG 5 cut(s) 254, 271, 337, 419, 525
FatI CATG 5 cut(s) 250, 267, 333, 415, 521
FokI GGATG 3 cut(s) 164, 206, 320
FriOI GRGCYC 1 cut(s) 241
FspBI CTAG 1 cut(s) 556
Hin1II CATG 5 cut(s) 254, 271, 337, 419, 525
HinfI GANTC 1 cut(s) 475
Hpy166II GTNNAC 4 cut(s) 69, 137, 199, 404
Hpy188I TCNGA 4 cut(s) 286, 356, 534, 543
Hpy188III TCNNGA 2 cut(s) 251, 381
Hpy8I GTNNAC 4 cut(s) 69, 137, 199, 404
HpyAV CCTTC 2 cut(s) 57, 529
HpyCH4III ACNGT 2 cut(s) 182, 260
HpyCH4V TGCA 5 cut(s) 41, 63, 224, 337, 362
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
HpyF3I CTNAG 4 cut(s) 14, 216, 240, 345
Hsp92II CATG 5 cut(s) 254, 271, 337, 419, 525
Kzo9I GATC 4 cut(s) 125, 247, 271, 351
LmnI GCTCC 1 cut(s) 374
LpnPI CCDG 5 cut(s) 36, 57, 227, 265, 348
LweI GCATC 1 cut(s) 349
MaeI CTAG 1 cut(s) 556
MalI GATC 4 cut(s) 127, 249, 273, 353
MboI GATC 4 cut(s) 125, 247, 271, 351
MboII GAAGA 2 cut(s) 266, 453
MfeI CAATTG 1 cut(s) 425
MflI RGATCY 1 cut(s) 271
MhlI GDGCHC 3 cut(s) 91, 241, 501
MluCI AATT 3 cut(s) 31, 425, 483
MmeI TCCRAC 1 cut(s) 285
MnlI CCTC 3 cut(s) 31, 184, 228
MseI TTAA 1 cut(s) 171
MslI CAYNNNNRTG 1 cut(s) 338
MspCI CTTAAG 1 cut(s) 170
MunI CAATTG 1 cut(s) 425
Mva1269I GAATGC 1 cut(s) 226
MwoI GCNNNNNNNGC 1 cut(s) 86
NdeII GATC 4 cut(s) 125, 247, 271, 351
NlaIII CATG 5 cut(s) 254, 271, 337, 419, 525
NlaIV GGNNCC 1 cut(s) 331
PagI TCATGA 1 cut(s) 250
PctI GAATGC 1 cut(s) 226
PfeI GAWTC 1 cut(s) 475
PspN4I GGNNCC 1 cut(s) 331
PspPI GGNCC 3 cut(s) 282, 404, 525
PsuI RGATCY 1 cut(s) 271
RsaI GTAC 2 cut(s) 68, 138
RsaNI GTAC 2 cut(s) 67, 137
RseI CAYNNNNRTG 1 cut(s) 338
SaqAI TTAA 1 cut(s) 171
Sau3AI GATC 4 cut(s) 125, 247, 271, 351
Sau96I GGNCC 3 cut(s) 282, 404, 525
SduI GDGCHC 3 cut(s) 91, 241, 501
SfaNI GCATC 1 cut(s) 349
SfcI CTRYAG 1 cut(s) 181
SinI GGWCC 3 cut(s) 282, 404, 525
SmiMI CAYNNNNRTG 1 cut(s) 338
SmlI CTYRAG 1 cut(s) 170
SmoI CTYRAG 1 cut(s) 170
Sse9I AATT 3 cut(s) 31, 425, 483
SspMI CTAG 1 cut(s) 556
TaaI ACNGT 2 cut(s) 182, 260
TasI AATT 3 cut(s) 31, 425, 483
TatI WGTACW 2 cut(s) 66, 136
TfiI GAWTC 1 cut(s) 475
Tru1I TTAA 1 cut(s) 171
Tru9I TTAA 1 cut(s) 171
TscAI CASTG 2 cut(s) 87, 265
TspDTI ATGAA 1 cut(s) 267
TspRI CASTG 2 cut(s) 87, 265
Vha464I CTTAAG 1 cut(s) 170
VpaK11BI GGWCC 3 cut(s) 282, 404, 525
XspI CTAG 1 cut(s) 556
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.