pycom16g10460

DNA primase is the polymerase that synthesizes small RNA primers for the Okazaki fragments made during discontinuous DNA replication

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Reverse (-)
7126700 .. 7127317
618 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 234 bp
ATGCATAGACGATATACCTATAAAGTGACGATTGTCATTGATATCATTTTTGTGGTTTCCCTTGTTGCCACACAATTCCGCAGTCTTCTATCAAAGGCACTTATTTTGACAAACAGAAAATGGACAACAACTATAGCAGAACAAGAGAAGGATCGATTGACTCCTATTGTTGAAGCCCTATCCTCAAGTTACCTGGGTCCTGACTATTCTGAGAGTTTGGTCAGATTTCCTTGA

Protein Analysis

78

Amino Acids

8.89

Weight (kDa)

9.52

Isoelectric Point (pI)

36.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 79
AclWI GGATC 1 cut(s) 159
AgsI TTSAA 1 cut(s) 173
AjnI CCWGG 1 cut(s) 192
AlwI GGATC 1 cut(s) 159
AspS9I GGNCC 1 cut(s) 197
AvaII GGWCC 1 cut(s) 197
BbsI GAAGAC 1 cut(s) 77
BciT130I CCWGG 1 cut(s) 194
BfmI CTRYAG 1 cut(s) 132
Bme1390I CCNGG 1 cut(s) 194
Bme18I GGWCC 1 cut(s) 197
BmgT120I GGNCC 1 cut(s) 197
BmiI GGNNCC 1 cut(s) 198
BmrFI CCNGG 1 cut(s) 194
BoxI GACNNNNGTC 1 cut(s) 32
BpiI GAAGAC 1 cut(s) 77
BpuEI CTTGAG 1 cut(s) 169
Bsa29I ATCGAT 1 cut(s) 154
BsaJI CCNNGG 1 cut(s) 193
BseBI CCWGG 1 cut(s) 194
BseCI ATCGAT 1 cut(s) 154
BseDI CCNNGG 1 cut(s) 193
BseMII CTCAG 1 cut(s) 201
BshVI ATCGAT 1 cut(s) 154
Bsp143I GATC 1 cut(s) 151
BspACI CCGC 1 cut(s) 79
BspCNI CTCAG 1 cut(s) 202
BspDI ATCGAT 1 cut(s) 154
BspLI GGNNCC 1 cut(s) 198
BspPI GGATC 1 cut(s) 159
BssECI CCNNGG 1 cut(s) 193
BssMI GATC 1 cut(s) 151
Bst2UI CCWGG 1 cut(s) 194
BstDEI CTNAG 1 cut(s) 210
BstKTI GATC 1 cut(s) 154
BstMBI GATC 1 cut(s) 151
BstNI CCWGG 1 cut(s) 194
BstPAI GACNNNNGTC 1 cut(s) 32
BstSCI CCNGG 1 cut(s) 192
BstSFI CTRYAG 1 cut(s) 132
BstV2I GAAGAC 1 cut(s) 77
Bsu15I ATCGAT 1 cut(s) 154
BsuTUI ATCGAT 1 cut(s) 154
Cfr13I GGNCC 1 cut(s) 197
ClaI ATCGAT 1 cut(s) 154
CviJI RGCY 1 cut(s) 176
CviKI_1 RGCY 1 cut(s) 176
DdeI CTNAG 1 cut(s) 210
DpnI GATC 1 cut(s) 153
DpnII GATC 1 cut(s) 151
Eco32I GATATC 1 cut(s) 43
Eco47I GGWCC 1 cut(s) 197
EcoO109I RGGNCCY 1 cut(s) 197
EcoRII CCWGG 1 cut(s) 192
EcoRV GATATC 1 cut(s) 43
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 4 cut(s) 6, 15, 21, 134
HinfI GANTC 1 cut(s) 160
Hpy188I TCNGA 2 cut(s) 211, 224
Hpy188III TCNNGA 1 cut(s) 200
HpyAV CCTTC 1 cut(s) 142
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 1 cut(s) 210
Kzo9I GATC 1 cut(s) 151
LpnPI CCDG 3 cut(s) 179, 206, 213
MaeIII GTNAC 2 cut(s) 25, 188
MalI GATC 1 cut(s) 153
MboI GATC 1 cut(s) 151
MboII GAAGA 1 cut(s) 77
MluCI AATT 1 cut(s) 74
MlyI GAGTC 1 cut(s) 154
MnlI CCTC 1 cut(s) 193
Mph1103I ATGCAT 1 cut(s) 6
MslI CAYNNNNRTG 1 cut(s) 50
MspR9I CCNGG 1 cut(s) 194
MvaI CCWGG 1 cut(s) 194
NdeII GATC 1 cut(s) 151
NlaIV GGNNCC 1 cut(s) 198
NmuCI GTSAC 1 cut(s) 25
NsiI ATGCAT 1 cut(s) 6
PleI GAGTC 1 cut(s) 154
PpsI GAGTC 1 cut(s) 154
PpuMI RGGWCCY 1 cut(s) 197
PshAI GACNNNNGTC 1 cut(s) 32
Psp5II RGGWCCY 1 cut(s) 197
Psp6I CCWGG 1 cut(s) 192
PspGI CCWGG 1 cut(s) 192
PspN4I GGNNCC 1 cut(s) 198
PspPI GGNCC 1 cut(s) 197
PspPPI RGGWCCY 1 cut(s) 197
RseI CAYNNNNRTG 1 cut(s) 50
Sau3AI GATC 1 cut(s) 151
Sau96I GGNCC 1 cut(s) 197
SchI GAGTC 1 cut(s) 154
ScrFI CCNGG 1 cut(s) 194
SetI ASST 2 cut(s) 20, 195
SfcI CTRYAG 1 cut(s) 132
SgeI CNNG 6 cut(s) 74, 155, 198, 205, 206, 212
SinI GGWCC 1 cut(s) 197
SmiMI CAYNNNNRTG 1 cut(s) 50
SmlI CTYRAG 1 cut(s) 184
SmoI CTYRAG 1 cut(s) 184
Sse9I AATT 1 cut(s) 74
SsiI CCGC 1 cut(s) 79
StyD4I CCNGG 1 cut(s) 192
TaqI TCGA 1 cut(s) 154
TasI AATT 1 cut(s) 74
TseFI GTSAC 1 cut(s) 25
Tsp45I GTSAC 1 cut(s) 25
VpaK11BI GGWCC 1 cut(s) 197
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.