RchiOBHm_Chr4g0407051

Protein trichome birefringence-like 6

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
29135761 .. 29136569
809 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 330 bp
ATGGGTTTTCACTTCTTGTTCTTTTGGCAAAATAATCTACCAGTAATTGTAAATCTGCTAGTAATTGTAAATCTGCTAGTTTCTTCTCGTTTCGATGGTTTTGATTTCAAGGCAACAAATATGCTAGAGCTAATAAGAGGGAAGAGACTAGTTTTTGTGGGTGATTCAATCAACAGAAATCAATGGGAATCCATGTTGTGCATGTTAATGGGAGCAATAAAAGATCTAAACAAGGTCTATGAGACTCACAGGCACAGAATCACCAAAGAAAAGGGAAATTACAGTTTTAGATTTGTGTTAATTCTACTTATCACAAGATTACAAGTGTAG

Protein Analysis

109

Amino Acids

12.89

Weight (kDa)

10.0

Isoelectric Point (pI)

23.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PC-Esterase PF13839 36 - 98 2.6e-19 GDSL/SGNH-like Acyl-Esterase family found in Pmr5 and Cas1p
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 109, 168
AhlI ACTAGT 1 cut(s) 148
AluBI AGCT 1 cut(s) 130
AluI AGCT 1 cut(s) 130
Alw26I GTCTC 2 cut(s) 139, 236
AsuHPI GGTGA 2 cut(s) 173, 253
BccI CCATC 1 cut(s) 89
BcoDI GTCTC 2 cut(s) 139, 236
BcuI ACTAGT 1 cut(s) 148
BfaI CTAG 4 cut(s) 59, 77, 125, 149
BglII AGATCT 1 cut(s) 223
Bse1I ACTGG 1 cut(s) 41
BseNI ACTGG 1 cut(s) 41
BsmAI GTCTC 2 cut(s) 139, 236
Bsp143I GATC 1 cut(s) 223
BsrI ACTGG 1 cut(s) 41
BssMI GATC 1 cut(s) 223
Bst4CI ACNGT 1 cut(s) 284
Bst6I CTCTTC 1 cut(s) 137
BstKTI GATC 1 cut(s) 226
BstMAI GTCTC 2 cut(s) 139, 236
BstMBI GATC 1 cut(s) 223
BstNSI RCATGY 1 cut(s) 205
BstX2I RGATCY 1 cut(s) 223
BstYI RGATCY 1 cut(s) 223
CviAII CATG 2 cut(s) 193, 202
CviJI RGCY 1 cut(s) 130
CviKI_1 RGCY 1 cut(s) 130
DpnI GATC 1 cut(s) 225
DpnII GATC 1 cut(s) 223
Eam1104I CTCTTC 1 cut(s) 137
EarI CTCTTC 1 cut(s) 137
FaeI CATG 2 cut(s) 196, 205
FaiI YATR 4 cut(s) 122, 194, 203, 240
FatI CATG 2 cut(s) 192, 201
FspBI CTAG 4 cut(s) 59, 77, 125, 149
Hin1II CATG 2 cut(s) 196, 205
HinfI GANTC 4 cut(s) 164, 188, 244, 258
HphI GGTGA 2 cut(s) 173, 253
HpyCH4III ACNGT 1 cut(s) 284
HpyCH4V TGCA 1 cut(s) 201
Hsp92II CATG 2 cut(s) 196, 205
Kzo9I GATC 1 cut(s) 223
LmnI GCTCC 1 cut(s) 212
LpnPI CCDG 2 cut(s) 54, 235
MaeI CTAG 4 cut(s) 59, 77, 125, 149
MalI GATC 1 cut(s) 225
MboI GATC 1 cut(s) 223
MboII GAAGA 2 cut(s) 75, 154
MflI RGATCY 1 cut(s) 223
MluCI AATT 4 cut(s) 45, 63, 277, 300
MlyI GAGTC 1 cut(s) 238
MnlI CCTC 1 cut(s) 131
MseI TTAA 2 cut(s) 206, 299
MslI CAYNNNNRTG 1 cut(s) 206
NdeII GATC 1 cut(s) 223
NlaIII CATG 2 cut(s) 196, 205
NspI RCATGY 1 cut(s) 205
PfeI GAWTC 3 cut(s) 164, 188, 258
PleI GAGTC 1 cut(s) 238
PpsI GAGTC 1 cut(s) 238
PsuI RGATCY 1 cut(s) 223
RseI CAYNNNNRTG 1 cut(s) 206
SaqAI TTAA 2 cut(s) 206, 299
Sau3AI GATC 1 cut(s) 223
SchI GAGTC 1 cut(s) 238
SetI ASST 2 cut(s) 132, 237
SmiMI CAYNNNNRTG 1 cut(s) 206
SpeI ACTAGT 1 cut(s) 148
Sse9I AATT 4 cut(s) 45, 63, 277, 300
SspMI CTAG 4 cut(s) 59, 77, 125, 149
TaaI ACNGT 1 cut(s) 284
TaqI TCGA 1 cut(s) 93
TasI AATT 4 cut(s) 45, 63, 277, 300
TfiI GAWTC 3 cut(s) 164, 188, 258
Tru1I TTAA 2 cut(s) 206, 299
Tru9I TTAA 2 cut(s) 206, 299
XceI RCATGY 1 cut(s) 205
XspI CTAG 4 cut(s) 59, 77, 125, 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.