RchiOBHm_Chr3g0487581

Acts as a sulfur carrier required for 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of cytosolic tRNA(Lys), tRNA(Glu) and tRNA(Gln). Serves as sulfur donor in tRNA 2- thiolation reaction by being thiocarboxylated (-COSH) at its C- terminus by MOCS3. The sulfur is then transferred to tRNA to form 2-thiolation of mcm(5)S(2)U. Also acts as a ubiquitin-like protein (UBL) that is covalently conjugated via an isopeptide bond to lysine residues of target proteins. The thiocarboxylated form serves as substrate for conjugation and oxidative stress specifically induces the formation of UBL-protein conjugates

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
34794851 .. 34797975
3125 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 300 bp
ATGCAGCTGACCGTAGAATTCGGTGGAGGATTAGAGCTTCTTTGTAACTCTGTCAAGATTCATAATGTCAATGTAGAACTGCAAAAGGCAGCAGAAAAGTTAACCATGAAAGATTTACTGGCTTGGATTCGTACTAATTTGATCAAGGAGAGGCCTGAAATGTTTATGAAAGGAGATTCTGTGAGACCTGGTGTTCTAGCCCTTGTGAATGATTGTGATTGGGAGCTGACTGGTCAACTTGATACAACACTAGAGGAGAAGGATGTGGTTGTTTTCATTTCAACCTTGCACGGCGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.06

Weight (kDa)

4.9

Isoelectric Point (pI)

23.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Urm1 PF09138 2 - 99 7.7e-38 Urm1 (Ubiquitin related modifier)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016072)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 294
AcsI RAATTY 1 cut(s) 17
AfaI GTAC 1 cut(s) 133
AgsI TTSAA 1 cut(s) 282
AjnI CCWGG 1 cut(s) 187
AluBI AGCT 3 cut(s) 7, 37, 226
AluI AGCT 3 cut(s) 7, 37, 226
Alw26I GTCTC 1 cut(s) 178
AoxI GGCC 1 cut(s) 152
ApeKI GCWGC 2 cut(s) 4, 89
ApoI RAATTY 1 cut(s) 17
BbvI GCAGC 2 cut(s) 16, 101
BciT130I CCWGG 1 cut(s) 189
BclI TGATCA 1 cut(s) 141
BcoDI GTCTC 1 cut(s) 178
BfaI CTAG 2 cut(s) 197, 251
BisI GCNGC 2 cut(s) 5, 90
BlsI GCNGC 2 cut(s) 6, 91
Bme1390I CCNGG 1 cut(s) 189
BmrFI CCNGG 1 cut(s) 189
BsaI GGTCTC 1 cut(s) 178
BsaXI ACNNNNNCTCC 2 cut(s) 165, 195
Bse1I ACTGG 2 cut(s) 123, 235
BseBI CCWGG 1 cut(s) 189
BseGI GGATG 1 cut(s) 268
BseNI ACTGG 2 cut(s) 123, 235
BseRI GAGGAG 1 cut(s) 269
BseXI GCAGC 2 cut(s) 16, 101
BshFI GGCC 1 cut(s) 154
BsmAI GTCTC 1 cut(s) 178
BsnI GGCC 1 cut(s) 154
Bso31I GGTCTC 1 cut(s) 178
Bsp143I GATC 1 cut(s) 141
BspACI CCGC 1 cut(s) 294
BspANI GGCC 1 cut(s) 154
BspTNI GGTCTC 1 cut(s) 178
BsrI ACTGG 2 cut(s) 123, 235
BssMI GATC 1 cut(s) 141
Bst2UI CCWGG 1 cut(s) 189
Bst4CI ACNGT 1 cut(s) 13
BstF5I GGATG 1 cut(s) 268
BstKTI GATC 1 cut(s) 144
BstMAI GTCTC 1 cut(s) 178
BstMBI GATC 1 cut(s) 141
BstNI CCWGG 1 cut(s) 189
BstSCI CCNGG 1 cut(s) 187
BstV1I GCAGC 2 cut(s) 16, 101
BsuRI GGCC 1 cut(s) 154
BtsCI GGATG 1 cut(s) 268
CsiI ACCWGGT 1 cut(s) 187
Csp6I GTAC 1 cut(s) 132
CviAII CATG 1 cut(s) 106
CviJI RGCY 6 cut(s) 7, 37, 122, 154, 200, 226
CviKI_1 RGCY 6 cut(s) 7, 37, 122, 154, 200, 226
CviQI GTAC 1 cut(s) 132
DpnI GATC 1 cut(s) 143
DpnII GATC 1 cut(s) 141
Eco147I AGGCCT 1 cut(s) 154
Eco31I GGTCTC 1 cut(s) 178
EcoRI GAATTC 1 cut(s) 17
EcoRII CCWGG 1 cut(s) 187
FaeI CATG 1 cut(s) 109
FaiI YATR 3 cut(s) 63, 107, 167
FatI CATG 1 cut(s) 105
FbaI TGATCA 1 cut(s) 141
Fnu4HI GCNGC 2 cut(s) 5, 90
FokI GGATG 1 cut(s) 275
Fsp4HI GCNGC 2 cut(s) 5, 90
FspBI CTAG 2 cut(s) 197, 251
GluI GCNGC 2 cut(s) 5, 90
HaeIII GGCC 1 cut(s) 154
Hin1II CATG 1 cut(s) 109
HincII GTYRAC 2 cut(s) 102, 236
HindII GTYRAC 2 cut(s) 102, 236
HinfI GANTC 3 cut(s) 58, 127, 176
HpaI GTTAAC 1 cut(s) 102
Hpy166II GTNNAC 2 cut(s) 102, 236
Hpy188III TCNNGA 1 cut(s) 55
Hpy8I GTNNAC 2 cut(s) 102, 236
HpyAV CCTTC 1 cut(s) 253
HpyCH4III ACNGT 1 cut(s) 13
HpyCH4V TGCA 3 cut(s) 4, 82, 289
Hsp92II CATG 1 cut(s) 109
Ksp22I TGATCA 1 cut(s) 141
KspAI GTTAAC 1 cut(s) 102
Kzo9I GATC 1 cut(s) 141
LmnI GCTCC 1 cut(s) 223
LpnPI CCDG 5 cut(s) 104, 168, 174, 201, 216
Lsp1109I GCAGC 2 cut(s) 16, 101
MabI ACCWGGT 1 cut(s) 187
MaeI CTAG 2 cut(s) 197, 251
MaeIII GTNAC 1 cut(s) 44
MalI GATC 1 cut(s) 143
MboI GATC 1 cut(s) 141
MluCI AATT 2 cut(s) 17, 136
MnlI CCTC 3 cut(s) 20, 144, 247
MseI TTAA 1 cut(s) 101
MspA1I CMGCKG 1 cut(s) 7
MspR9I CCNGG 1 cut(s) 189
MvaI CCWGG 1 cut(s) 189
NdeII GATC 1 cut(s) 141
NlaIII CATG 1 cut(s) 109
PceI AGGCCT 1 cut(s) 154
PfeI GAWTC 3 cut(s) 58, 127, 176
PkrI GCNGC 2 cut(s) 6, 91
Psp6I CCWGG 1 cut(s) 187
PspGI CCWGG 1 cut(s) 187
PvuII CAGCTG 1 cut(s) 7
RsaI GTAC 1 cut(s) 133
RsaNI GTAC 1 cut(s) 132
SaqAI TTAA 1 cut(s) 101
SatI GCNGC 2 cut(s) 5, 90
Sau3AI GATC 1 cut(s) 141
ScrFI CCNGG 1 cut(s) 189
SetI ASST 5 cut(s) 9, 39, 190, 228, 287
SexAI ACCWGGT 1 cut(s) 187
Sse9I AATT 2 cut(s) 17, 136
SseBI AGGCCT 1 cut(s) 154
SsiI CCGC 1 cut(s) 294
SspMI CTAG 2 cut(s) 197, 251
StuI AGGCCT 1 cut(s) 154
StyD4I CCNGG 1 cut(s) 187
TaaI ACNGT 1 cut(s) 13
TasI AATT 2 cut(s) 17, 136
TfiI GAWTC 3 cut(s) 58, 127, 176
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TseI GCWGC 2 cut(s) 4, 89
TspDTI ATGAA 4 cut(s) 50, 122, 182, 265
XapI RAATTY 1 cut(s) 17
XspI CTAG 2 cut(s) 197, 251
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.